أنصار السنة  
جديد المواضيع





للإعلان هنا تواصل معنا > واتساب
 حفر ابار في افريقيا   Online quran classes for kids 
منتدى السنة | الأذكار | زاد المتقين | منتديات الجامع | منتديات شباب الأمة | زد معرفة | طريق النجاح | طبيبة الأسرة | معلوماتي | وادي العرب | حياتها | فور شباب | جوابى | بنك أوف تك


العودة   أنصار السنة > حوار الأديان > رد شبهات الملاحدة العرب

إضافة رد
 
أدوات الموضوع
  #101  
قديم 2012-08-21, 12:06 AM
عادل أحمد عادل أحمد غير متواجد حالياً
عضو جديد بمنتدى أنصار السنة
 
تاريخ التسجيل: 2012-07-26
المشاركات: 18
افتراضي

بما أن السؤال - أخي - لا يتعلق بعلم الجينات أو الإحاثة أو الانتخاب الطبيعي، فأرجو أن استميحك عذراً عن عدم الرد عليه أيضاً
رد مع اقتباس
  #102  
قديم 2012-08-21, 02:30 AM
أبو حب الله أبو حب الله غير متواجد حالياً
محـــاور
 
تاريخ التسجيل: 2011-10-24
المشاركات: 305
افتراضي


على الرغم من عدم إجابتك أخي الكريم عادل -بما أريد وبعد قرابة 6 ساعات - عن سؤالي لك :

اقتباس:
هل قرأت كتاب أصل الأنواع : النسخة العربية التي أشرت أنت لها بالفعل ؟؟؟؟..
وذلك رغم أني أرى معرفك منذ الصباح في الموضوع : ومنذ قرابة الساعتين أيضا ً:
إلا أني سأبادر أنا بكتابة الرد ...
والله المستعان ...

أنت قلت أخي :

اقتباس:
لك التحية أخي العزيز وأتمنى أن يمر عليك كل عام ويجدك في أتم صحة وعافية.
- أولاً: فيما يخص تعليقك عن أنني قرأت وأنا على توجيه مسبق لعدم الالتفات لأي شيء يختلف معي، فأنا أكف عن الرد عن هذه الملاحظة تهذيباً وتقديراً لشخصك أخي العزيز.
- وأما فيما يتعلق باستدلالك بوجهة نظر العالم (لامارك) عن توارث الصفات المكتسبة فأنا سأعود بك إلى كتاب أصل الأنواع للكاتب تشارلز داروين في ترجمة مجدي محمود المليجي عن دار المجلس الأعلى للثقافة، الطبعة الأولى عام 2004، في فصل (نبذة تاريخية عن تطور المعتقدات حول نشأة الأنواع الحية قبل نشر الطبعة الأولى لهذا العمل)، وفي تعليق الكاتب على كتاب (الفلسفة الحيوانية) للكاتب (لامارك) الذي استددلت به على التوارث بناءً على انتقال الصفات المكتسبة، يقول الكاتب في صفحة (39):
وفيما يتعلق بالوسائل التي تمت عن طريقها التعديلات، فإنه – أي لامارك – عزا بعضاً من منها إلى التأثير المباشر للعوامل الطبيعية للحياة، وبعضاً منها إلى التهجين بين الأشكال الموجودة فعلاً، والكثير منها إلى الاستخدام وعدم الاستخدام، وهذا ما يعني تأثيرات السلوك، ويبدو أنه يعزو إلى هذا العامل الأخير كل التكيفات الجميلة في الطبيعة، مثل العنق الطويل للزرافة.
وبما أن الفصل يتحدث عن المعتقدات التي سبقت نشر مصنفه فمن غير الجائز المحاجة بدراسة سبقت النظرية لدحضها، كما يدل على اختلاف الكاتب مع لامارك فيما يتعلق بآلية التوريث.
- في الباب الثاني من الكتاب، التمايز تحت تأثير الطبيعة، في القسم (الاختلافات الفردية) يقول الكاتب (أن الاختلافات الفردية البسيطة التي تظهر على الذراري التابعة لنفس الأبوين، هي التي تزود الانتخاب الطبيعي بالأدوات اللازمة للعمل عليها).
وبذلك يحدد الكاتب الميكانيكية التي يقوم عليها التطور، وهو الفروق الفردية بين الأفراد الناتجين عن نفس الأصل، وليس الصفات المكتسبة عنهما.
أما في الفصل الرابع (الانتقاء الطبيعي - البقاء للأصلح) يقول الكاتب في تلميح عن التمايز تحت تأثير التدجين في صفحة 160:
(إن الإنسان لا يستطيع استحداث ضروب، ولا يستطيع أن يمنع ظهورها، ولكنه يحتفظ ويكدس كل ما يحدث على علاته.
وجملة (يكدس ما يحدث على علاته) فيها إشارة قوية لأن العملية تلقائية ولا دخل للصفات المكتسبة بها.
- ويقول الكاتب في صفحة 161:
العديد من الكتاب قد أخطأوا الفهم أو اعترضوا على مصطلح الانتقاء الطبيعي، وبعضهم وصل إلى أنه تخيل أن الانتقاء الطبيعي يسبب التمايز، مع أنه لا يتضمن إلا الحفاظ فقط على مثل هذه التمايزات كما تظهر.
وهذه إشارة من الكاتب لأن التميزات تتكدس كما تظهر، وليس كما ينقلها الآباء عن طريق توريث الصفات المكتسبة في فترة بقاء الأبوين.
- في صفحة 352 يقول الكاتب:
فإنه قد يكون من المستحسن أن نشرح مرة أخرى كيف سيقوم الانتقاء الطبيعي بدوره في جميع الحالات العادية، فالإنسان قد قام بتعديل البعض من حيواناته بدون الحاجة للاهتمام بتفاصيل خاصة في التركيب، وذلك ببساطة عن طريق الحفاظ والاستيلاد من أسرع الأفراد، كما في حالة حصان السباق وكلب الصيد السلوقي، أو كما فعل في حالة ديك المصارعة، وذلك بالإنسال من الطيور المنتصرة، وهذا هو الحال مع الزرافة في بداية نشوئها تحت ظروف الطبيعة، فإن الأفراد التي كانت ترعى على مستوى عالي، وكانت قادرة أثناء فترات القحط على أن تصل إلى مستوى أعلى ولو ببوصة واحدة أو بوصتين فوق الآخرين، فهي التي كانت غالباً سوف تبقى، وذلك لأنها سوف تكون قد جاست خلال بقاع القطر بحثاً عن الطعام.
ويستمر الكاتب في نفس الصفحة:
وحقيقة الأمر أن الأفراد التابعة لنفس النوع، غالباً ما تختلف في الأطوال النسبية لجميع أجزاء جسدها، وذلك من الممكن مشاهدته في العديد من أعمال التاريخ الطبيعي، والتي تقدم لنا قياسات دقيقة في هذا الموضوع، وتلك الاختلافات النسبية الناتجة عن قوانين النمو وتعدد الخصائص، ليس لها فائدة أو أهمية على الإطلاق لمعظم الأنواع. ولكن الأمر كان سيصبح مختلف مع الزراف الناشئ، عندما نضع في الاعتبار عاداته الحياتية المحتملة، فتلك الأفراد التي كان لها جزء واحد أو أجزاء متعددة من نجسدها أكثر استطالة فإنها في العادة كانت سوف تبقى على قيد الحياة. وهي التي كانت ستتزاوج وتتكر ذرية، إما وارثة لنفس الميزات الجسدية أو لديها القابلية لتعديل الخصائص مرة أخرى على نفس المنوال.
وستمر الكاتب:
وإنه لمن المشكوك فيه إذا ما كان قد طرأ على تفكير أحد أن يدرب كلباً على الإرشاد إذا لم يكن هناك كلب ما قد أبدى بطريقة طبيعية قابليته لهذا المسار.
وفي هذا أيضاً إشارة من الكاتب لأن القابلية تكون طبيعية للتمايز، وليست ناتجة عن اكتساب من الأبوين.
وعليه لا يمكن الأخذ بآراء العالم لامارك للمحاجة بها على نظرية التطور فيما يخص تمرير الصفات السلوكية المكتسبة للكائن
- أما تعبيرك المقتبس من داروين (أنه لا يجد أي صعوبة في أن تتحول سلالة من الدببة بواسطة الانتخاب الطبيعي : وعن طريق المزيد من عاداتها المائية : وبالمزيد من اتساع أفواهها أكبر وأكبر : إلى أن تنتج لنا مخلوقا ًضخما ًمثل الحوت)
فأنا للأسف لم أجد في الكتاب الصفة التي يرد فيها هذه النقطة، لذلك أرجو منك أن تساعدني بتحديد الصفحة التي ورد فيها هذا التعبير حتى أعرف ما الذي كان يقصده الكاتب من ذلك.
وأقول لك في نقاط ...

1...
بالنسبة لما نقلته لك من رأي داروين في تطور سلالة من الدببة إلى حيتان : بفعل المزيد من العادات المائية !!!.. والمزيد من اتساع أفواهها أكبر وأكبر !!!.. فهذه كانت من صورة فاكس الطبعة الأولى لكتابه أصل الأنواع عام 1964 :
CHARLS DARWIN , HARVORD UNI.PRESS;THE ORIGIN OF SPEICIER: A FACSIMILE OF THE FIRST EDITION 1964 ص. 184

وقد ذكرت لك أنه تم حذفها من المقدمة !!!.. ولذلك - وبالطبع - :
فلن تجدها في الكتاب : لا في نسخته الإنجليزية : ولا في العربية المترجمة !!!..
ولكن : لا بأس :
فما سأذكره لك الآن من كتابه نفسه :
سيفي بالغرض إن شاء الله وزيادة : وكما سترى معي بعد لحظات ....
ولكن قبل أن أترك هذه النقطة :
فتلك الخزعبلات التي أشار إليها داروين في مقدمة كتابه : وتم حذفها من المقدمة ومن صفحة 184 أيضا ً:
تجد الإشارة إليها في صفحة الويكيبديا - الحيتانيات التالية :
http://ar.wikipedia.org/wiki/%D8%AD%...8A%D8%A7%D8%AA

ولكنك لن تجدها في النسخة الإنجليزية لنفس صفحة الويكيبديا !!!.. بل : ولن تجد أي ذكر لداروين أصلا ًفي الصفحة - وحتى لا يهتز عرش خرافة التطور أكثر مما هو يتهاوى بالفعل في السنوات الأخيرة !!!- .. وإليك اقتباس للإشارة إلى ذلك الجزء المحذوف ...
حيث تجد في صفحة الويكيبديا - وتحت عنوان : (نبذة عن تطور الحيتان) :

اقتباس:
في سنة 1859 كان لداروين توضيحات (بشكل نظري) كيف قد نشأت الحيتان (Cetacea) الحالية. حسب داروين فانّ الحيتان والدلافين اصلهم يرجع إلى ثديات اليابسة, تلك الثديات التي كانت تحصل على معظم غذائها في الوسط المائي لذلك تكيّفت تلك الثديات مع الوسط الجديد, وكان العالم لامارك Lamarck يعتقد عكس ذلك, إذ انه كان يعتقد بان ثدييات اليابسة أن اصلها يرجع إلى ثديات الماء.
وضرب داروين مثالا على ذلك وهو الدبّ الاسود, كان زميل له رآه في قارة أمريكا الشمالية, ذلك الشخص رأى الدب الاسود يسبح في بركة ماء بشكل متواصل لساعات عديدة دون توقف من اجل اصطياد الحشرات. إذا استمر هذا الدبّ (أو اي من حيوان ثدي آخر) ولاجيال عديدة جدا يبحث معظم وقته عن الغذاء في الماء فانه سيتكيف ويتصرف مثل الحيوانات المائية وبشكل تدريجي. وتبدأ اجسامهم بالتكيّف (التغيّر) من اجل سباحة وغطس أفضل, وبعد مدة طويلة (ملايين السنين) وبشكل تدريجي ينشأ حيوان على شاكلة الحيتان أو كلاب البحر.
وإليك النص المحذوف بأكمله من الصفحة 184 : وفيه تعليق داروين على ما رآه صديقه هيرني :

In North America the black bear was seen by Hearne swimming for hours with widely open mouth, thus catching, like a whale, insects in the water. Even in so extreme a case as this, if the supply of insects were constant, and if better adapted competitors did not already exist in the country, I can see no difficulty in a race of bears being rendered, by natural selection, more and more aquatic in their structure and habits, with larger and larger mouths, till a creature was produced as monstrous as a whale.
Charles Darwin, The Origin of Species (1859 and 1984 editions), p. 184.

والنص كان موجودا ًفي أول طبعة 1859 وإلى طبعة عام 1984 ص 184 !!!..

2...
أنت تحتج عليّ أخي الكريم بأنه : طالما ذكر داروين في : نبذته التاريخية عن تطور المعتققدات حول نشأة الكائنات الحية : أنه ذكر فيها لامارك وما اعتقده من (( توريث الصفات المكتسبة )) : فأنت تحتج عليّ أن ذلك دليلا ًعلى أن داروين لم يكن موافقا ًعلى ذلك !!!..
أقول :
من أين جئت بهذه القاعدة أخي لكريم ؟!!!..
معلوم أن الكثير من الباحثين وقبل الشروع في بحثه أو كتابه : يشير إلى مجهودات غيره الذين سبقوه في نفس المجال : سواء المخطئين منهم أو المصيبين !!!..
وذلك ما فعله داروين بالضبط !!!!..
وإلا :
فهو كما ذكر لامارك : فقد ذكر معه الكثيرون - لو أنك قرأت هذا الجزء من الكتاب أصلا ً- .. وعلى رأسهم ألفريد راسل والاس A.R. Wallace : والذي سبق داروين بتلخيص فكرته عن التطور : وباعتراف داروين نفسه !!!.. ولكن لمع نجم وصيت داروين : وغطى كتابه في الأهمية على رسالة والاس عن التطور بالانتخاب ...! ربما لكثرة ما كتبه داروين وألفه نتيجة خبراته من رحلاته ...
والسؤال :
هل يعتبر ذكر داروين أيضا ًلوالاس : هل يعتبر ذلك أنه غير موافقا ًعلى ما ذهب إليه والاس ؟!!!..
والحق أنك لو كنت قرأت كل هذا الجزء من كتاب داروين - وليس أوله فقط حينما ذكر لامارك - : لعرفت أنه هناك الكثيرين الذين أخذ عنهم داروين الكثير من معطيات نظريته وفرضياته : وباعترافه هو نفسه !!!!..
ولكني .........
سأترك كل ذلك وأسألك عن لامارك نفسه ...
أنت قلت :

اقتباس:
وفي تعليق الكاتب على كتاب (الفلسفة الحيوانية) للكاتب (لامارك) الذي استددلت به على التوارث بناءً على انتقال الصفات المكتسبة، يقول الكاتب في صفحة (39):
وفيما يتعلق بالوسائل التي تمت عن طريقها التعديلات، فإنه – أي لامارك – عزا بعضاً من منها إلى التأثير المباشر للعوامل الطبيعية للحياة، وبعضاً منها إلى التهجين بين الأشكال الموجودة فعلاً، والكثير منها إلى الاستخدام وعدم الاستخدام، وهذا ما يعني تأثيرات السلوك، ويبدو أنه يعزو إلى هذا العامل الأخير كل التكيفات الجميلة في الطبيعة، مثل العنق الطويل للزرافة.
وبما أن الفصل يتحدث عن المعتقدات التي سبقت نشر مصنفه فمن غير الجائز المحاجة بدراسة سبقت النظرية لدحضها، كما يدل على اختلاف الكاتب مع لامارك فيما يتعلق بآلية التوريث.
أقول :
ولماذا تريد أنت التفريق بين المحاجة بتوريث الصفات المكتسبة : فتتركه !!
ثم لا تترك قول لامارك بالتهجين ؟!!!!!.. ورغم موافقة داروين عليه أيضا ًوتخصيصه لجزء لا بأس به من كتابه له ولشرحه ؟!!!!..
فلماذا هذه الانتقائية أخي الكريم في الأخذ والترك من لامارك :
رغم أنك ترى أن ذكر داروين له في تلك النبذة عن (تاريخ) معتقدات التطور : لا يصلح للمحاججة به ؟!!..
غريب ........ صح ؟؟..

3...
والآن إلى صلب الإجابة ....
هل قرأت أخي الكريم : أول باب من كتاب داروين بنفسك ؟؟؟؟؟....
هل قرأت ثاني فصل فيه ؟؟؟...
سواء في نسخته الإنجليزية :



أو حتى العربية :



أقول لك أخي الكريم :
في هذا الفصل من بدايات كتاب داروين نفسه :
يقوم بالتعليق فيه على ما كان سائدا ًفي وقته من معتقد توريث الصفات المكتسبة !!!..

< أي لم أكن أكذب عليك قط عندما أخبرتك بذلك !!!! والحمد لله رب العالمين >

بل :
ويتحدث فيه عن أشهر الآليات التي ذكرها لامارك في نظريته عن التطور واستطالة الأعضاء - مثل عنق الزرافة - ألا وهي آلية :
الاستخدام وعدم الاستخدام - أو - الاستعمال والإهمال !!!!!..
فماذا قال داروين أخي ؟؟؟..
أترك لك ولكل قاريء التعليق على الكلام التالي .......



هه ؟؟؟.. ما رأيك في هذا الكلام الصريح والواضح والمباشر منه ؟!!!..
يقول في أول سطر :

<< السلوكيات التي تتغير : تحدث تأثيرا ًوراثيا ً>> !!!

ما شاء الله !!!.. يعني داروين لم يكن ملاكا ًأخي عادل ولا معصوما ًمن هذه الغلطة الساذجة !!!!!!..
والعبارات التي وضعتها لك في مستطيلات زرقاء :
هي عبارات موافقته على هذه الخزعبلات في وقته : واطمأنانه لها !!!!!..
وذلك في خضم المثالين الذين تحدث عنهما في هذه الصفحة وهما :
اختلاف وزن عظام جناح البط .. واختلاف حجم أثداء البقر والماعز !!!!..

ومن هنا أخي الكريم ... وقبل أن أستكمل معك باقي النقل من كتابه :
فداروين كان متخبطا ًمثله مثل غيره في تفسير الإعجاز في ملائمة أعضاء الكائنات الحية لبيئاتها !!
ومن ضمن فرع الشجرة الذي كان مستمسكا ًبه من الغرق في بحر ذلك التخبط :
هو القول بالتحور في البيئة واكتساب صفات يتم توريثها للأبناء !!!!..
نعم ... لم يكن ذلك عند داروين هو الآلية الوحيدة لظهور الصفات :
ولكنه مثله في ذلك مثل غيره - مثل لامارك الذي أشرت أنت له - : كان يضع آليات أخرى :
مثل التهجين مثلا ً- وهنا خلط ساذج آخر بين التطور الأصغر كما يسمونه وبين التطور الأكبر - !!!..
وفي النهاية :
كلها تخرصات وافتراضات من قوم عاشوا قبل عصر الانفتاح العلمي على حقائق الوراثة وإعجاز الخلية والـ DNA !

فمثال الزرافة : لن يتأثر داروين بمن أين أتت الزرافة طويلة العنق :
هل من الفروق الفردية العادية من الطول والقصر كأي كائن حي : أم من الاستعمال كما قال لامارك :
وإنما الذي يهم داروين هو عمل الانتخاب الطبيعي في استخلاص ذلك النوع من الزراف الطويل القامة دونا ًعن غيره ليبقى !!!...

ولأتابع معك ...
حيث ترى معي في الصورة التالية بوضوح :
عزوه لسبب تدلي أذن بعض الحيوانات الداجنة إلى : عدم الاستخدام !!!!!!!!!!!!!!!!..
< نفس أقوال لا مارك !!!!!!!!!!!!!!!!!!!!! فقط لكي تصدقني أخي بارك الله فيك >
وتصريحه الذي وضعته لك في المستطيل الأحمر بأن هذا التفسير هو : الاتجاه الراجح !!..
وإليك الصورة :



ومن قرب نهاية هذا الفصل :
نجد أن هذه النظرة القاصرة منه : طالت أيضا ًالنباتات وليس الحيوانات فقط ...!
حيث نجده في معرض حديثه عن موضوع (( الارتداد )) في عودة الصفات الوراثية للأصل :
يتحدث عن تجربة من خياله وهي : وضع نبات الكرنب في تربة مجدبة :
ثم يفترض (مؤكدا ً) على أن التغييرات التي ستحدث للكرنب ساعتها ونسله بعد ذلك :
ستكون بتأثير التربة وتلك البيئة المجدبة ......!!!..
وإليك الصورة :



وأما الجملة التي أحطتها بسحابة زرقاء في آخر الصفحة :
فهي واحدة من مئات المرات - بلا أدنى مبالغة - والتي يستخف بها داروين بسخافة افتراضاته :
وعدم اهتمامه بعدم تحققها قبل ولا بعد : رغم أنه يبني عليها نظريته المتهافتة !!!..
وأما لكي تفهم ما أعنيه أكثر أخي :
فأرجو قراءة - أو حتى مطالعة - الرابط التالي من مدونتي بعنوان :
2)) بين يدي داروين في كتابه :
http://abohobelah.blogspot.com/2012/06/2.html

وأختم معك أخي بهذه الصورة لآخر ما قاله في هذه الفصول الأولى من بابه الأول :
حيث نرى تأكيدا ًوتصريحا ًبتعلق الصفات المكتسبة للفقد : وهذه المرة بـ (الارتداد) :



4...
ومما سبق أخي :
فلا أجد الحاجة للتعليق على باقي كلامك بأكمله : والذي انتقيته أنت من كتاب داروين :
وخلعت عليه شروحات من عندك أنت :
لا تـُلزمه في شيء بقدر ما وضحت لك الآن من تصريحاته هو نفسه !!!!..
وأما بالنسبة لموضوع الزرافة التي عنقها أطول ببوصة أو بوصتين :
فأرجو مراجعة ردي عليك فيها - وخصوصا ًردي الثاني الذي خصصتك به وليس الأخ عبد الحق - ..
أو إعادة قراءته كاملا ً- الردين معا ً- من هنا :
http://abohobelah.blogspot.com/2012/...g-post_31.html

مع العلم بأني يمكنني أن أستطرد في ذكر عوائق ولا معقوليات أخرى لم أذكرها في وجه هذا التفسير الخرافي لطول عنق الزرافة ..
ولكني دوما ًأحب ادخار وقتي وبعض ردودي لمناسبات أخرى ...

وفقني ووفقك الله ..
وهداني وإياك إلى ما يحب ويرضى ...
وعلمني وإياك ما جهلنا : ووفقنا للعمل بما علمتنا ...

وملحوظة أخيرة :
أقول :
سبحان الله الذي يقلب سلاح المعاندين للإسلام : إلى سلاح للإسلام !!!!..
فهذا الكتاب أصل الأنواع :
ظل عفريتا ًوبعبعا ًورمزا ًلتخويف المتدينين منه ورميهم بالتخلف والرجعية إلخ :
طالما لم يجد مَن يرد عليه ويفصصه !
وذلك لعدم وجود نسخة مترجمة منه ومنتشرة انتشارا ًكافيا ًلنقدها !!!..

ثم يوقف الله تعالى أعداء هذا الدين نفسه لترجمة الكتاب :
فيتبين به سخافة كاتبه وعقله الذي سخره فقط - وكما يقول هو في نبذته التاريخية عن التطور - :
لإثبات ابتعاد ( الإعجاز الإلهي ) عن عملية الخلق !!!!..
وبهذا : يفتح باب الإلحاد على مصراعية بإيجاد ( بديل ) بزعمه للخالق عز وجل !!!..
فاستبدل في عقيدته ومَن تبعه : الله تعالى الخالق الحكيم المدبر العليم الخبير :
بطبيعة صماء عمياء !!!!..

فقام بترجمة الكتاب لأول مرة :
أحد الليبراليين المصريين - وهي عادتهم في تهافتهم على كل ما يطعن في الدين من كتب الغرب - :
ألا وهو المدعو : إسماعيل مظهر ...


ثم أعاد جابر عصفور العلماني الفج : نفخ الروح في الكتاب بترجمة عربية جديدة :


تخدع ببهرجها مراهقي وشباب وعوام وبسطاء الشعوب العربية والإسلامية :
وهي ترجمة علماني آخر - أو تغريبي حداثي إن صح التعبير - وهو : مجدي محمود المليجي ..
وتقديم نصراني وهو المدعو : سمير حنا صادق ...

وكل ٌمنهم له فحيحه المسموم المكتوم للمز وغمز الدين باعتبار نظرية التطور هذه :
مقيضة له - مثلما فعلت نظرية جاليليو بالكنيسة الأوروبية في زعمهم - ..
وهنا أود الإشارة فقط لما جاء في هامش الصفحة الرابعة من الكتاب والتي كتبوا فيها :



فالجملة الأخيرة التي خططت تحتها بالخط الأحمر – والتي يظنون أنها تعفيهم من المسؤلية - :
هي أشبه بما نقوله بالعامية المصرية : " يقتل القتيل : ويمشي في جنازته " !!..
حيث ماذا تغني هذه الجملة :
مقارنة ًبنفث السم (الواضح) في الهوامش والتقديم والمقدمة :
ومن كل مَن امتلأ قلبه وعقله جهلا ًوحقدا ًوغيظا ًمن الدين ؟؟!!..
حيث اهتموا بذكر نبذة مما كتبه إسماعيل مظهر المترجم الأول للكتاب من قبل :
ولم يذكروا للقاريء أنه ليبراليذكروني بالملحد بسام البغدادي مترجم وهم الإله لداوكينز - !!!..
وأما الذي نضح بما في داخل قلوبهم من حقد وغل على الدين وثوابته
< والتي هي في نظرهم رجعية وتخلف وجمود > :
فهو ما نقرأه في تعليق المترجم مجدي محمود المليجي على نبذة إسماعيل مظهر :


فيا ليت قومي يتعظون !!!!..

__________________


<< حضور متقطع >>
حوار مع مسلم - اضغط هنا
ما يجب أن تعرفه عن نظرية التطور - اضغط هنا
هدم أسس الإلحاد - اضغط هنا
مدونتي - اضغط هنا
فرق ومذاهب وأحزاب وأديان معاصرة - اضغط هنا
إلى كل نصراني - اضغط هنا
فضح جهالات المدعو عمر المناصير - اضغط هنا
حقيقة المجوس الشيعة الروافض - اضغط هنا
عقد الضفيرة على شانئي أبي هريرة - اضغط هنا
الثورة المصرية .. وعقول ٌسلفية - اضغط هنا
رد مع اقتباس
  #103  
قديم 2012-08-23, 02:54 PM
أبو حب الله أبو حب الله غير متواجد حالياً
محـــاور
 
تاريخ التسجيل: 2011-10-24
المشاركات: 305
افتراضي


متفرقات ..
نبذة عن نشأة فكرة التطور قديما ًوحديثا ً..

ما زلت إخواني أسعى إلى جمع كل المشاركات التي أراها مهمة - حتى ولو عرقلت الترتيب المفترض للمواضيع - وذلك لفضح أكذوبة التطور وتعريتها هنا :
وأنقل لكم الآن ردي على سؤال للأخ الحبيب بحب ديني للتعريف بالتطور من وجهة نظر داروين والتطوريين حيث قال :

اقتباس:
أكتب نبذة عن ماهية التطور كما وصفه وعبر عنه دارون والتطوريين ؟
فكانت الإجابة : والتي نقلتها أيضا ًفي رابط تنسيق مواضيع التطور في مدونتي هنا :
http://abohobelah.blogspot.com/2012/...g-post_28.html
---------------

بسم الله الرحمن الرحيم ...
وكعادتي أخي الحبيب : سأضع ردي في نقاط لسهولة القراءة والتتبع ..

1...
في الماضي لاحظ الإنسان بفطرته العادية : تدرج ترتب المخلوقات على بعضها البعض .. بمعنى : أن الإنسان على رأس السلاسل الغذائية : يتغذى مثلا ًعلى الحيوانات (برية بحرية والطيور) وعلى النبات .. يليه الحيوان بتدرجاته .. يليه النبات .. وهكذا .. حتى يقبع في النهاية الجماد الأصم ... واشتهرت تلك السلسلة وذلك الترتيب باسم :
(( السلسلة العظمى للموجودات ))

2...
أشار الكثير من الفلاسفة والعلماء لهذا التدرج والترتيب قديما ًمنذ اليونان (أفلاطون) .. ومرورا ًحتى ببعض الفلاسفة والعلماء المسلمين ..
وهو أشبه بعمليات تقسيم الكائنات الحية لسهولة دراستها في العصر الحديث :
نباتات كذا وكذا .. فقاريات .. لا فقاريات .. إلخ

3...
نلاحظ فيما سبق : أنه لا أحد قال بـ (تطور) أحد هذه السلسلة إلى الذي يليه وإنما فقط : (ترتيب) !!!..

4...
عند ترجمة كتاب أصل الأنواع لداروين : للغة العربية أول مرة على يد إسماعيل مظهر الملحد :
فقد كتب هذا الأخير نبذة في مقدمة كتابه : حاول أن يثبت فيها قدم فكرة التطور والنشوء والارتقاء في التاريخ الإنساني عموما ً!!!..
وذلك ليوحي بأنها فكرة (فطرية) ليست غريبة على العقل الإنساني أبدا ًتخيلها !!!!..
< هكذا هي الأفكار الشاذة : لا تصدر إلا عن شواذ العقيدة التائهين في بحر الحياة >

فبدأ بالإشارة إلى أقوال الفيلسوف الإغريقي أنتكسمندر (والصواب : أنكسيمندر Anaximander عاش 610 : 540 قبل الميلاد) ..
والله أعلم بأمانة النقل لإسماعيل مظهر : ولكنه أوحى للقاريء بأن (تقسيم مراتب الكائنات) : يوحي بـ (تطورها من بعضها البعض) !!!!..
وحاول نسبة ذلك أيضا ًبالتلميح تارة وبالتصريح تارة : لبعض مشاهير الإسلام أنفسهم على اختلاف مشاربهم مثل إخوان الصفا وابن مسكويه الخازن وابن خلدون والجاحظ إلخ ...

5...
ومن أبرع مَن تصدى لهذه الخزعبلات بالتفنيد وجزاه الله خيرا ًعنا - فقد أغنانا عن كثير بحث وتنقيب وترجمة - : هو أخ في الله : أفتخر أني أكتب في نفس الصرح الذي كتب ويكتب فيه هنا في منتدى التوحيد - وأدعو الله تعالى ألا يحرمنا من مجهوداته - ألا وهو الدكتور : حسام الدين حامد وفقه الله وحفظه من كل سوء ..

6...
فأما بالنسبة لتفنيد الدكتور حسام لمزاعم نسبة القول بالتطور لإخوان الصفا وأرسطو وابن رشد الحفيد إلخ وذلك في موضوعه : (( خرافة نسبة نظرية التطور لأهل القبلة : من قبل داروين )) :
http://www.eltwhed.com/vb/showthread...CF%C7%D1%E6%E4

والذي كتبه ردا ًعلى مزاعم الشيخ عبد الصبور شاهين المتأثر بكل هذه الأكاذيب :
فقد لخصته لكم منسقا ًومرتبا ًفي موضوع (ما يجب أن تعرفه عن نظرية التطور) : وتجدونه في الرابط التالي من مدونتي تحت اسم :
أكذوبة ما أسموه بنظرية التطور المحمدية :
http://abohobelah.blogspot.com/2012/...g-post_06.html

7...
وعلى ذلك تتبقى أكذوبة واحدة لإسماعيل مظهر في نبذته عن قدم فكرة التطور التي ادعاها في مقدمة ترجمته لكتاب داروين أصل الأنواع : وتلك الأكذوبة هي : ما نقله ونسبه إلى الفيلسوف الإغريقي القديم أنتكسمندر (والصواب كما قلنا هو : أنكسيمندر Anaximander) والذي عاش 610 : 540 قبل الميلاد !!!..
وسأورد لكم كلامه الذي نقله أولا ً: ثم الكلام الحقيقي ثانيا ً:
لنعرف أن عدم الأمانة أو أخطاء النقل : هي صفة لصيقة للباطل لكي يستطيع فقط الوقوف ولو لقليل أمام الحق فيخدع العوام والبسطاء والجهال لبعض الوقت !!!..
فقد نقل وكتب هذا الملحد :
" وأقدم ما وصل إلينا مما عُثر عليه إلى الآن من تراث الأقدمين، هو ما قاله الفيلسوف الإغريقي "أنتكسمندر" (610 ق. م) "أن نشأة الكائنات الحية هو نتيجة تأثير الشمس على الأرض، وتميز العناصر المتجانسة بالحركة الدائمة، وأنّ الأرض كانت في البداية طينيةً ورطبةً أكثر مما هي عليه الآن، فلما وقع فعل الشمس دارت العناصر الرطبة في جوفها، وخرجت منها على شكل فقاقيع، وتولدت الحيوانات الأولى، غير أنّها كانت كثيفةً ذات صورٍ قبيحةٍ غير منتظمة، وكانت مغطاةً بقشرةٍ كثيفةٍ تمنعها من الحركة والتناسل وحفظ الذات، فكان لابد من نشوء مخلوقاتٍ جديدة، أو بسبب ازدياد فعل الشمس في الأرض لتوليد حيواناتٍ منتظمة يمكنها أن تحفظ نفسها وتزيد نوعها، أما الإنسان فإنّه ظهر بعد الحيوانات كلها، ولم يخل من التقلبات التي طرأت عليه، فخُلقَ أول الأمر شنيع الصورة ناقص التركيب، وأخذ يتقلب إلى أن حصل على صورته الحالية" (5)، وهذه الفقرة تحمل معظم مبادئ أصل الحياة والنشوء والارتقاء، والانتقاء والتمايز وتأثير الظروف المحيطة، وإذا كانت قد كُتبت من ستة قرونٍ قبل الميلاد، فلابد من وجود تلالٍ من المحررات المماثلة السابقة لهذه الحضارة المتوسطة الموضع في سجل الحضارات " !!!..

وعزى إسماعيل مظهر هذا النقل إلى : (( دائرة المعارف العربية للبستاني )) !
ويمكن الاطلاع على كلامه ذلك في الصفحة 52 من الترجمة العربية الثانية لكتاب أصل الأنواع لمجدي محمود المليجي ..

< ملحوظة : البستاني هذا صاحب دائرة المعارف تلك : هو نصراني واسمه : بطرس بن بولس بن عبد الله البستاني .. وكتبها أيام حكم الخديوي إسماعيل على مصر >

8...
وبالطبع الكلام المنقول خطأ أعلاه : مربك لكل باحث عن الحق يعلم بجلاء أن خرافة التطور البلهاء : لم تظهر إلا متأخرا ًعند مَن كرهوا الخالق عز وجل في صورة الكنيسة الأوروبية المتخلفة والغاشمة الظالمة !!!..
وهكذا هي كل شبهة للملاحدة وغيرهم تكون قائمة على الكذب أو الخطأ أو عدم الأمانة :
فهي تربك المسلم العادي في أولها .. وإلى أن تنفتح عيناه على الحق بإذن الله ..

< حاولت الاطلاع على دائرة المعارف هذه لأعرف أصل الخطأ : هل هو من كاتبها النصراني : أم تعمد تحريف من إسماعيل مظهر : ولكني للأسف لم أحصل إلا على المجلد الأول فقط منها ولم يكن قد انتهى بعد من حرفي الألف والباء التي تليه !! >

وهنا قام دكتورنا الفاضل حسام الدين حامد في موضوعه : (( وإذن : ليس أصل الإنسان سمكة )) :
http://www.eltwhed.com/vb/showthread...%D3%E3%DF%C9!!

قام بنقل أصل كلام وعقيدة أنيكسمندر ..
< ولاحظوا فرق المعنى بين ما ستقرأونه الآن : وما قام بنقله إسماعيل مظهر > :
فأنيكسمندر هو :
" أعظم أعلام المدرسة الأيونية منزلةً، وأوسعها شهرةً، وأكبرها أثرًا " ..
المصدر : الانقطاعات المعرفية في الفكر الفلسفي اليوناني حتى عصر أرسطو – سمر سمير أنور – صفحة 46.

وأما فكرته الحقيقية فهي :
" أنه يرى أن الحيوانات جميعًا كانت بدايتها في المياه محاطةً بلحاءٍ شائك، وبعد ذلك انتقلت إلى الأجزاء اليابسة من الأرض فانشق عنها اللحاء، وعاشت على الأرض حينًا من الزمن، استبقت فيه نوعها بالتناسل، ولما كان الإنسان يختلف عن هذه الكائنات، من جهة كونه لا يستطيع حماية نفسه في صغره، ويحتاج إلى سنين عديدةٍ ليستطيع القيام بشأن نفسه، وبالتالي فخروجه إلى اليابسة رضيعًا دون أسرةٍ تحميه، يعني أنّه سيموت فينقرض نوعه وهذا ما لم يحدث، خرج أنكسيمندر من هذه المعضلة باستثناء الإنسان من هذا العموم، فزعم أن الإنسان نشأ عن الأسماك، بعد أن ظل في جوفها حتى بلغ سنًّا يؤهله، لحماية نفسه والتكاثر ثم حماية نسله، وليس هناك ما يمنع أن يكون أنكسيمندر قال بهذا القول في سائر الحيوانات، التي يعجز صغارها عن رعاية نفسها في وقتٍ قصير، ولكنّ الذي بلغنا هو قوله في الإنسان وحسب " !!!..
المصدر : The Presocratic Philosophers – Jonathan Barnes – P 15

والفرق طبعا ًواضح أنه حتى ذلك الفيلسوف الإغريقي بفكرته الأسطورية الخرافية تلك : لم يدع نشوء الكائنات الحية من لا شيء ثم تطورها من بعضها البعض !!!..

9...
وبمثل هذه المقدمة الغير صحيحة لإسماعيل مظهر : سواء في ادعاءاته على مشاهير الإسلام : أو عدم تحريه (( بنفسه )) ما نقله عن الفيلسوف الإغريقي لأهميته : فضلا ًعن ادعاءه كذبا ًأنه يسبق ذلك حتما ًفي التاريخ الإنساني الكثير مثله : أقول بتلك المقدمة الغير صحيحة :
فقد تأثر بها الكثيرون للأسف ممَن وثقوا بأدعياء الثقافة والتعلم والتحضر والمدنية الغربية !!!..
وإلى أن سار على نفس النهج في التزييف والتحريف وغمز عقيدة الخلق الإلهي :
المشروع الثاني لترجمة الكتاب تحت عناية العلماني جابر عصفور المصري ..
ومعها مقدمة تفخيمية بأسلوب النفخ في التراب للنصراني : سمير حنا صادق : حتى وصل به التفخيم إلى أن نسب لنظرية داروين - والتي قال أنها صارت حقيقة علمية لا شك فيها بتاتا ً- نسب إلى تلك النظرية المتهافتة كل إنجاز علمي وطبي اليوم تقريبا ًفي استخفاف عجيب بعقل القاريء !!!!..
ثم أكمل على نفس اللحن مترجم الكتاب : العلماني أو التغرييبي أو الحداثي : مجدي محمود المليجي ...
-------------------
---------------------------

وهنا أقف قليلا ً...
وأعتذر في كل ما سبق : إن كنت قد أطلت و (( رغيت )) شوية معاكو أخي الحبيب بحب ديني ...
ولكنها الرغبة في نقل صورة أكثر اتساعا ًلكل مَن لا خبرة له بأساس المسألة !!..

وفي الجزء التالي :
أستعرض معكم ومن كلام داروين نفسه : مَن سبقه في العصر الحديث بفكرة النشوء والارتقاء للكائنات الحية ..

يُـتبع بعد قليل إن شاء الله ...
---------


10...
في الترجمة الثانية لكتاب داروين : أصل الأنواع : وهي التي لمجدي محمود المليجي : واسمها :
(( أصل الأنواع ..
نشأة الأنواع الحية : عن طريق الانتقاء الطبيعي أو :
الاحتفاظ بالأعراق المفضلة : في أثناء الكفاح من أجل الحياة
))
فقد أوردوا من الصفحة 37 : نبذة تاريخية كان قد كتبها داروين قبل نشر الطبعة الأولى من كتابه :
عن : تطور المعتقدات حول نشأة الأنواع الحية ...
حيث ذكر عددا ًكبيرا ًممَن سبقوه بالقول بكل أساطير وفرضيات التطور كما سنرى :
وكيف أنهم لما كان منتشرا ًبينهم خرافة (( التوالد التلقائي )) للكائنات الحية أو العضوية : ولو من الجمادات !!..
فاستخفوا - ومعهم داروين - بنشوء أول كائن حي أو عضوي أو غيره في تدرجه المزعوم !
وصار كل عالم منهم يضع خيالاته وافتراضاته في إطار نظرية أو فكرة أو مقال كما سنرى !!!..
حيث كان يُظن في ذلك الوقت مثلا ًأن الحشرات : تنشأ من بقايا الطعام لو تركتها لفترة !!..
ويُظن أن الفئران : تنشأ من الشعير !!..
ويُظن أن البكتيريا : تنشأ من الجمادات !!..
ويُظن أن اليرقات : تنشأ من قطع اللحم !!..
ولم ينتبه هو ومعاصريه إلى أن الذباب مثلا ً: كان هو الذي يجلب هذه اليرقات للحم !!..
تلك اليرقات الصغيرة جدا ًوالتي لا ترى بالعين المجردة !!..
وإلى أن قضى لويس باستير على كل هذه السفاسف بعملية البسترة وبعد كتابة داروين لكتابه ..
والآن ...
تعالوا نذكر أولئك الذين قرأ لهم داروين وتابعهم وأخذ عنهم أفكاره :

1...
أرسطو : ونسب إليه فكرة التطور .. وساق مثالا ًغبيا ًجدا ًلأرسطو عن اختلاف شكل الأسنان مع وظيفة كل منها (الضروس والأنياب والقواطع إلخ) .. والكلام كله لا وزن له من العلم .. وليس فيه تصريح ٌبالتطور بمفهوم داروين أصلا ً.. فضلا ًعن أن المشهور عن أرسطو هو ثبات الأنواع : ويُرجى قراءة ذلك من رابط موضوع الدكتور حسام الأول الذي وضعته لكم : أو من رابط مدونتي الذي وضعته لكم أيضا ً...

ثم انتقل داروين مباشرة للحديث عن القائمة الحديثة :
ونلاحظ أنهم كلهم نتاج عصر كره للكنيسة : حيث دفعهم للرغبة في التملص من أوثق عقائدها الدينية وهي عقيدة الإله الخالق : لمعرفتهم بالتأثير المباشر لذلك على الإلحاد والتمرد بالتالي على سيطرة الكنيسة في أوروبا في ذلك الوقت حتى على العلم ..
وتعالوا لنرى معا ً: مَن ذكرهم داروين في العصر الحديث :

2...
حيث ذكر بوفون Buffon .. وذكر أنه أشار إلى تحولات الكائنات الحية من بعضها إلى البعض : ولكنه كان متقلبا ًفي رأيه هذا مترددا ً: ولم يذكر أو يقترح أي وسيلة لهذا التحول (مثل القول بأنه نتيجة طفرات أو تحورات لملائمة الطبيعة إلخ) .. ولهذا لم يقف داروين عنده كثيرا ً- هكذا قال داروين -

3...
ثم يأتي الدور الأكبر في لفت النظر إلى النشوء والإرتقاء في الكائنات الحية وتحولها : إلى العالم لامارك Lamarck !!!.. حيث يصفه داروين بأنه أسدى ( خدمة جليلة ) بلفت النظر لأن التغييرات التي تحدث في العالم العضوي وحتى الغير عضوي : يمكن جدا ًأن تكون نتيجة قانون : وليس لتدخل إعجازي !!! - يقصد تدخل إلهي : وهو نفس ما سار عليه داروين في كل كتابه وصرح به في أكثر من موضع ومنها عند حديثه عن العين - ..
وقد أعلن لامارك عن أفكاره لأول مرة عام 1801م ..
ثم زاد عليها وأضاف إليها في كتابه (الفلسفة الحيوانية) عام 1809م ..
ثم ختمها بكتابه (التاريخ الطبيعي للحيوانات الفقارية) 1815م ..
وأشار داروين إلى تأثر لامارك في أفكاره هذه عن تحول الكائنات من بعضها إلى البعض - بما فيها الإنسان - إلى ملاحظات لامارك للعديد من التشابهات بين الكائنات الحية وما يحدث في التهجين من خلط للصفات إلخ ...
وأما الوسائل التي ذكرها لامارك لهذا التحول - والنشوء والارتقاء بحد تصريح داروين - فهي :

1-
التأثير المباشر للعوامل الطبيعية ..
ويقصد به أن تؤثر الطبيعة على الكائن الحي : فتتحور أعضاؤه ليتكيف معها : فيتطور ويترقى إلى كائن آخر مختلف في الصفات !!.. ثم يورث ذلك إلى أبنائه !!!.. وكل هذه الفكرة البلهاء تم نسفها تماما ًفيما بعد على يد العالم (وايزمان) وتجربته الشهيرة في قطع ذيول الفئران لمدة 19 جيل !!!.. أي بما يعادل 570 سنة في عمر البشر : وكانت تولد الفئران بذيول في كل مرة !!!.. بل نحن كبشر - وكمسلمين تحديدا ً- : نختن أولادنا الذكور لمدة زادت عن الـ 1400 سنة : وفي كل مرة يولد ذكورنا غير مختونين !!!..
وهذه القاعدة العلمية الوراثية المعروفة اليوم اسمها :
(( الصفات المكتسبة (أي في حياة الكائن الحي) لا تورث (أي إلى أبنائه) ))
فالنجار والحداد يكتسبون قوة العضلات مثلا ًفي حياتهما : ولكنهما لا يورثونها لأبنائهما من بعدهما !!!..

2-
وأما الوسيلة الثانية فهي التهجين ..
حيث وقع لامارك في نفس الخطأ الذي تبعه فيه داروين وهو : اعتقادهم ( عمياني كده ) أن التهجين في يوم من الأيام ومع طول الزمان : قد ينتج أنواعا جديدة من الحيوانات !!!.. وهذه خرافة بالطبع : لا تقل في سماجتها عن الوسيلة الأولى التي اقترحها لامارك !!!..
لأن التهجين ومهما كان : فهو ينتج أبناء : من نفس النوع ولا يخرج عنه !!!..
فالحصان العربي الأصيل يتم تهجينه مع حصان أوروبي أو غيره : فينتجان حصانا ًوليس أسدا ًمثلا ً!!!..
بل وحتى إذا اتسعت الدائرة : فقمنا بتهجين حصان مع حمار : فينتجان بغلا ً: ويكون دوما ًمقطوع النسل أي لا يلد !!!..
ولا ينتجان مثلا ًقردا ًولا غوريلا !!!..
وحتى لو لقحنا هذا البغل صناعيا ًمع غيره : فلن يخرج عن دائرة الحصان والحمار والبغل !!!..
ولمزيد من المعلومات الهامة جدا ًعن حدود التهجين : أرجو قراءة الرابط التالي :
هل إمكانية التهجين : تدل على التطور ؟؟؟..
http://abohobelah.blogspot.com/2012/06/6_4690.html
والسبب في كل ذلك :
أن لكل نوع من الكائنات الحية : ما يعرف بالحوض الجيني الخاص به : والذي لا يمكن أن يتعداه إلى غيره : إلا ميتا ً(كمَن يحاول تلقيح كلب بحمار أو قط بدجاجة إلخ فيموت الجنين أو الوليد المشوه) .. ويمكن مطالعة الرابط التالي أيضا ًلمزيد المعلومات عن الحوض الجيني : العقبة الكؤود أمام الداروينيين والتطوريين :
http://abohobelah.blogspot.com/2012/06/6.html
ومن هنا :
يتبين لنا خبث الداروينيين الجدد والتطوريين عندما قاموا بتسمية التهجين وما ينتج عنه من تغيرات في الصفات بـ : التطور الأصغر microevolution وذلك ليوحوا للعوام والبسطاء والجهال أنه يمهد بالتأكيد ويدل على التطور الأكبر macroevolution !!!..
وكل ذلك من خبثهم العلمي والإعلامي بالطبع ...
ونعود إلى لامارك في تخبطه وعماه : ومع الوسيلة الثالثة عنده للتحول وهي :

3-
الاستخدام وعدم الاستخدام ..! أو : الاستعمال والإهمال ..!
ويقصد بها : أن العضو الذي يُستخدم كثيرا ً: ينمو ويطول أو يتضخم .. والذي لا يُستخدم : يتضاءل ويتصاغر أو يتلاشى ..
وأشهر مثال على ذلك ساقه هو : طول عنق الزرافة التي كانت في الأصل قصيرة العنق !
ولكنها عندما أكثرت من مد عنقها لأعلى : استطال إلى الشكل الذي نراه الآن !!!..
وبالطبع هذه الخرافة الثالثة هي الأخرى : تلتحق بأختيها السابقتين في مزبلة التاريخ والعلم !
فلا حفريات الكائنات الحية المكتشفة تثبتها ...! ولا أي فرع محترم من فروع علم الأحياء !!!..
< ملحوظة : يُطلق على آثار الكائنات الحية الميتة منذ آلاف السنين وأكثر : اسم حفريات : ومثلها المتحجرات >
فحفريات كل كائن حي منذ ملايين السنين باعترافهم أنفسهم : هي هي مثلها مثل نفس ذلك الحيوان اليوم !!!..
وأما المفاجأة التي لا يعرفها الكثيرون :
فهي أن داروين نفسه كان متأثرا ًبأفكار لامارك الساقطة تلك - فالذي باع عقله للتنصل من ربه : تستهويه أي فكرة بالغة ما بلغت من التفاهة - وفي الرابط التالي تجدون الأدلة من كتاب داروين نفسه أصل الأنواع :
http://abohobelah.blogspot.com/2012/...g-post_21.html
وبذلك ننتهي من لامارك ..
أشهر أوائل مَن أثاروا فكرة التحول في الكائنات الحية : وتأثر بها داروين ..

4...
جيوفروي سانت هيلاري Geoffroy Saint-Hilaire .. وقد نشر ابنه كتابا ًعن حياته : أخبر فيه بأنه بدأ بالشك ربما عام 1795م في أن ما يسميه الناس أنواعا ًمن الكائنات الحية : ما هي إلا تطورات من بعضها البعض !!!.. ولكنه لم ينشر من ذلك شيئا ًإلى أن جاء عام 1828م .. وفيه صرح بأعتقاده أن الكائنات الحية لم تكن هكذا منذ أن وُجدت !!.. ويُرجع داروين ذلك الرأي لجيوفروي : لنظرته لتأثير البيئات على الكائنات الحية - أي تقريبا ًنفس الوسيلة الأولى التي قال بها لامارك - ..
ولكنه - ويا للغرابة - ولكي يهرب من أي محاولة لتخطئته قال : أنه لا يعتقد أن الكائنات الحالية الآن تمر بنفس التحول !!!..
وأن هذه مشكلة المستقبل - على حد تعبير ابنه - !!!..

5...
الدكتور و. س. ويلس W. D. Wells .. وهو الذي أخذ عنه داروين فكرة الانتخاب أو الانتقاء الطبيعي !!!.. ولكن لمع نجم داروين لشبابه ربما وتوسيعه للقاعدة لتشمل كل الكائنات الحية والصفات : بخلاف ويلس الذي قصر ذكرها على الإنسان وعلى بعض الصفات التي ذكرها في هذا الصدد فقط !!..
حيث في عام 1813م ألقى الدكتور ويلس أمام الجمعية الملكية بحثا ًعنوانه :
(( وصف لأنثى بيضاء : يتشابه جزء من جلدها مع جلد أي زنجي )) !!!.. ولكن لم يتم نشر البحث حتى ظهور كتابه (( مقالتان عن الرؤية المبهمة والرؤية الواضحة )) عام 1818م !!.. وهو الذي أظهر فيه الإشارة إلى الانتقاء الطبيعي : حيث تنتقي الطبيعة الزنوج والأخلاس (الأخلاس هم الخلطاء مثل المولود لزنجي وبيضاء مثلا ً) : تنتقيهم الطبيعة في المناطق الحارة لأنهم لديهم المناعة ضد بعض أمراض تلك المناطق !!!..
ويفرقه عن داروين كما قلنا : أنه قصر حديثه هنا على البشر وبعض صفاتهم تحديدا ً!!.. بعكس داروين الذي توسع في تطبيق الفكرة : فكان هذا سبب التصاقها به في شهرته على ما يبدو ...
ولكن اتفق ويلس أيضا ًمعه في ملاحظته لـ :
1- أن الكائنات الحية تختلف اختلافات وتمايزات ولو إلى درجة ما فيما بينها ..
2- أن المزارعين يقومون بالتهجين لتحسين حيواناتهم الداجنة بانتقاء السلالات وتزويجها ..
فأشار ويلس إلى أن هذا الانتقاء هو ما تقوم به الطبيعة : ولكن بطريقة أكثر بطءا ً!!!..
وأقول أنا أبو حب الله :
إن كان الرجل صدق فيما افترضه لمحاولة تفسير تمركز الزنوج في المناطق الحارة : فقد كذب والله في نسبته الانتقاء للطبيعة !!.. فلا الطبيعة لديها كيان : ولا علم : ولا حتى إدراك للتمييز ولا اختيار : فضلا ًعن عجزها التام عن إنشاء هذه المخلوقات ابتداء ً: ثم تمايزاتها وتنوعاتها في كل حيوان ليلائم طبيعته تماما ًبتمام !!!.. ولكنه رب العالمين سبحانه ...
وجدير بالذكر أن تفسير الدكتور ويلس لتمركز الزنوج في المناطق الحارة : قد قام بمثله لتفسير تمركز البيض في المناطق الباردة أيضا ً..
وقد أشرت أنا لقريب من هذه المسألة قرب نهاية الصفحة التالية :
http://abohobelah.blogspot.com/2012/08/6_11.html

>>>
وهنا .. ومنعا ًللتطويل والتكرار بغير داعي ...
فسوف أذكر (باختصار) مجموعة ما ذكره داروين بعد ذلك من مجموعة علماء في النباتيات وغيره : اتفقوا على عدة مباديء تمهد لفكر داروين .. سواء استخفافهم بإعجاز الحياة نتيجة فكرة التوالد التلقائي ونشوء الحياة وتحولها ولو في مستنقع آسن هكذا وبعيدا ًعن التعقيدات !!.. وأن الأنواع التي نتجت من التهجين في فترات من الزمن - نباتية أو حيوانية - : هي التي صارت بعد ذلك أنواعا ًثابتة : ولكنها غير قابلة للتهجين من جديد !!!.. إلى آخر هذه الافتراضات عن النشأة الأولى للكائنات وتحولها : والتي إن أردنا أن نجمع آراءهم كلهم على جملة واحدة بما فيهم داروين ومَن بعده إلى اليوم لقلنا :
(( الخيال المحض الذي لا دليل عليه إلى الافتراض للتملص من الخلق المباشر من الله عز وجل ))

وهؤلاء الذين ذكرهم داروين في نبذته قبل صدور أول طبعة من كتابه عام 1859م هم :
(وسوف أضع معهم : اسم وعام أشهر ما كتبوه واستدل به داروين) :

6...
1822م : و. هيربرت W. Herbert
الجزء الرابع من موسوعته (المعاملات البستانية) وكتابه عن (الفصيلة النرجسية)

7...
1826 - 1834م : الأستاذ جرانت Prof. Grant
الفقرة الاستخلاصية من مقاله عن (الإسفنجيات) - محاضرته الـ 55 في مجلة (لانسيت)

8...
1831م (مكتوبة بالخطأ 1931م) - 1860م : باتريك ماثيو Patrech Matthew
بحث عن (الأخشاب المناسبة للبحر وزراعة الأشجار)

9...
1836م : فون بوش Von Bush
كتابه (الوصف المادي لجزر الكناري)

10...
1836م : رافينيك Rafinesque
كتابه (الحياة النباتية الجديدة في أمريكا الشمالية)

11...
1843- 1844م : هالديمان Haldeman
الجزء الرابع من مجلة (بوسطن للتاريخ الطبيعي للولايات المتحدة)

12...
1844م : كاتب مجهول
في الطبعة العاشرة 1853م من كتابه (الآثار المتبقية من الخليقة) ص 155 :
حاول دمج التطور والتغير بالعناية الإلهية - مثلما يحاول بعض المسلمين اليوم - .. وقد نقده داروين - رغم سعادته به لإثارته للموضوع أصلا ًفي بلد مثل انجلترا في ذلك الوقت كتمهيد لما سيأتي - قد نقده داروين في حصره لأساليب التغير بالطفرات !!.. وبثبات الصفات المكتسبة من الطبيعة !!.. وضرب داروين مثالا ًعلى تلك الصعوبة في تخيل التطور بالطفرات المفاجئة مثلا ًبأن تخرج لنا طائرا ًمثل نقار الخشب !!!..
< ولذلك نجد الداروينيين والتطوريين بالانتخاب الطبيعي : دوما ًضد القائلين بالتطور بالطفرات >

13...
1846م : م. ج. دوماليوس دهالوي M. J. d'Omalius d'Halloy
بحث له في (نشرات معهد بروكسل الملكي - الجزء 13)

14...
1849م : أوين Owen
كتابه (طبيعة الأطراف) - خطابه إلى (الجمعية البريطانية) 1858م
وهو الشخص الذي انخدع به داروين حيث كان يظنه ممَن يعولون على ثبات الخلق الإلهي وانفصال كل حيوان عن الآخر : ثم تبين له أنه لم يكن يقصد بتعبيره : (العملية المستمرة للقوة الخالقة) أنه معها !!.. ولكنه قصد أن المؤمن بها لن يستطيع تفسير غرائب الكائنات الحية مثل قصر وجود طائر الكيوي في نيوزيلنده .. وكذلك حالة طائر الطهيوج الأحمر !!.. وهو ما ظهر أكثر في كتابه بعد ذلك (علم التشريح الخاص بالفقاريات) .. حيث اعترف بأن الانتقاء الطبيعي قد يكون له تأثير في تكوين نوع جديد : مع اعترافه بأن ذلك لا دليل عليه أو غير صحيح !!!..
وقد اشتكى أوين : أنه قال بالانتقاء الطبيعي قبل داروين !!!..
ودافع داروين عن نفسه أن كتابات اوين نفسها صعبة ومتضاربة أحيانا ً..
وفي النهاية : يعلن داروين أنه سواء هو أو أوين :
فقد سبقهما للقول بالانتقاء الطبيعي كل ٌمن : الدكتور ويلس : والأستاذ ماثيو !!!..

15...
1851م : الدكتور فريك Freke
دورية صادرة له من (مطبعة دبلن الطبية) : أعلن عن احتمال انحدار جميع الكائنات العضوية من شكل واحد بدائي !
ولكن داروين يقول أنه يختلف معه في الخلفيات الخاصة بإيمانه وبطريقة معالجته للموضوع !!..
وله مقالة 1861م بعنوان (نشأة الأنواع الحية عن طريق الصلة العرقية العضوية)

16...
1852- 1858م : هيربرت سبينسر Herbert Spencer
مقالة له في مجلة (القائد) للمقارنة بين نظريات الخلق : والنشوء والارتقاء .. ثم افتراضه تحول الكائنات تأثرا ًبالبيئة

17...
1852م : م. نودين M. Naudin

مقالته عن (نشأة الأنواع الحية) عزى الانتقاء لما أسماه (القوة المطلقة) ولكنه لم يفسر آلياتها الطبيعية ..

18...
1853م : الكونت كيسرلنج Count Keyserling

فكرته التي اقترحها في المجلد الثاني - الجزء العاشر من (نشرة الجمعية الجيولوجية) وهي أنه كما أن أمراضا ًجديدة قد نتجت من بعض الأبخرة العفنة المنبعثة من مستنقع : فظهرت للوجود بعد أن لم تكن موجودة : ثم انتشرت : فكذلك يمكن أن يكون قد حدث تأثير كيميائي على بذور الأنواع الحية الأولية : فأنتجت أشكالا ًجديدة من الكائنات الحية : هي الموجودة حاليا ً!!!..

19...
1853م : الدكتور شكافهوزن Schaaffahausen

نشر كتيبا ًعن (نشوء وتطور الأشكال العضوية على الكرة الأرضية)

20...
1854م : م. ليكوك M. Lecoq

كتب الجزء الأول من (التعلم في الجغرافيا النباتية) ..

21...
1855م : بادن بويل Baden Powell

تحدث عن رؤيته الجديدة عن فلسفة الخلق في مقالاته عن (اتحاد العوالم) .. وذهب فيها إلى أن نشوء أنواع الكائنات الحية هو عملية نظامية وليست عرضية : أو هي عملية طبيعية : ولا تخضع للعمليات الإعجازية !!!..

22...
1850م : فون بير Von Baer

صرح بفكرته أن الأشكال الحية المختلفة حاليا ً: لم تكن إلا لشكل أبوي واحد في الماضي !

23...
1859م : الأستاذ هكسلي Prof. Huxley

ألقى محاضرة أمام (المؤسسة الملكية) عن (الأنماط الدائمة الخاصة بالحياة الحيوانية)

24...
1859م
(مكتوب بالخطأ 1895) : الدكتور هوكر Hooker
كتابه (مقدمة إلى الحياة النباتية الأسترالية) يقول فيه بالنشوء وتعديلات الأنواع

25...

وأخيرا ً: ولأكثر من مرة خلال كل ذلك : يعترف داروين بأسبقية والاس إلى القول بالانتقاء الطبيعي ... ويذكر أن ذلك موجود في الجزء الثالث من (جريدة الجمعية اللينيائية) .. وسميت كذلك نسبة ًإلى عالم النبات السويدي كارل فون ليني ..
------------

وهكذا نرى أن داروين : لم يكن مبدعا ًعلى قدر ما كان ناقلا ًومُجمعا ً: تحذوه مشاعره الإلحادية للتملص من سلطان الخالق عز وجل : مثله مثل أكثر مَن تأثر بهم في أفكاره تلك ..
وهذا رابط يبحث في إيمان داروين وإلحاده :
http://abohobelah.blogspot.com/2012/06/6_1219.html

وقد رأينا معا ًكيف أن ذلك القرن التاسع عشر : وفي الخمسين عاما ًبالضبط التي سبقت صدور كتاب داروين
الأول في التطور أصل الأنواع (لأنه له كتب أخرى ورسائل علمية سابقة .. ثم له كتاب ثاني عن التطور أكثر خرافة وسماجة وابتذالا ًوغباءً من أصل الأنواع وهو : أصل الإنسان)
: في هذه الخمسين عاما ًكانت واضحة ٌجدا ًتلك الإرهاصات التي تنتظر ولادة إلحادية لتجمع كل هذه التخرصات والأكاذيب والفرضيات المتهافتة : وتسلكها في فرضية واحدة تخرج للناس في شكل نظرية علمية براقة خادعة - فلو لم يكن داروين لكان غيره ! - : ولكن تميز داروين عن غيره بـ :
1-
قوة الدافع الداخلي - والتي تظهر بوضوح في تخطيه عمدا ًعلى عشرات الصعاب والمستحيلات في نظريته : مهونا ًإياها وموحيا ًبأنها لن تهدم نظريته إلا القليل منها الذي لم يستطع أن يماطل فيه مثل معضلة عدم كشف المستقبل على ملايين الحفريات الانتقالية والتغيرات المفترض أنها حدثت لتنتقي منها الطبيعة الأصلح : وهو ما لم ولن يتحقق وإلى اليوم - ..
2-
خبرة مشاهداته الواسعة لمختلف الكائنات الحية في رحلاته البحرية الطويلة ...
3-
تعميماته لأسس فرضياته لتشمل ظهور الحياة على شكل الأرض مرورا ًبكل صورها : مما أكسبها عمومية لنظريته افتقدها غيره كما رأينا بالأعلى ..

وأعتذر مرة أخرى على الإطالة ...
وأرجو أن أكون بهذا قد أعطيت كل مَن يحتاج :
المقدمة الكافية له ليعرف عن ماذا تدور أفكار التطور وكيف نشأت ..

والله الموفق ...

__________________


<< حضور متقطع >>
حوار مع مسلم - اضغط هنا
ما يجب أن تعرفه عن نظرية التطور - اضغط هنا
هدم أسس الإلحاد - اضغط هنا
مدونتي - اضغط هنا
فرق ومذاهب وأحزاب وأديان معاصرة - اضغط هنا
إلى كل نصراني - اضغط هنا
فضح جهالات المدعو عمر المناصير - اضغط هنا
حقيقة المجوس الشيعة الروافض - اضغط هنا
عقد الضفيرة على شانئي أبي هريرة - اضغط هنا
الثورة المصرية .. وعقول ٌسلفية - اضغط هنا
رد مع اقتباس
  #104  
قديم 2012-08-24, 06:05 PM
عادل أحمد عادل أحمد غير متواجد حالياً
عضو جديد بمنتدى أنصار السنة
 
تاريخ التسجيل: 2012-07-26
المشاركات: 18
افتراضي

أعذرني أخي العزيز، فأنا أحضر في إجابتي، فردودي ليست جاهزة بقدر جاهزيتك واستعدادك، ولكن حال انتهائي من تحضير الرد ستجد مني الرد في القريب، وإلى ذلك الحين أرجو منك مشاهدة هذا الفيديوhttp://www.youtube.com/watch?v=FATFX37Px-o
رد مع اقتباس
  #105  
قديم 2012-08-24, 06:30 PM
أبو حب الله أبو حب الله غير متواجد حالياً
محـــاور
 
تاريخ التسجيل: 2011-10-24
المشاركات: 305
افتراضي


أهلا ًبك من جديد أخ عادل ...
بالنسبة لشبهة الدونكي ريتشارد : فقد سبقك بها أحد الزملاء في منتدى التوحيد :
يمكنك متابعة الردود هنا :
http://www.eltwhed.com/vb/showthread...D5%CD%CA%E5%C7

وأما سؤالي أنا لك هو :
هل تتفق فعلا ً(( وكمسلم )) مع هذا الدونكي على وجود أخطاء وغباء فعلا ًفي بعض تفاصيل الكائنات الحية ؟!!!..

أتمنى الإجابة الصريحة هذه المرة وليس تهربا ًكما فعلت في سؤالي لك عن قراءتك لكتاب التطور !
ومع العلم أيضا ًأني سأتغيب لساعات قليلة من الآن لظرف الخروج ...

والله الهادي ...
__________________


<< حضور متقطع >>
حوار مع مسلم - اضغط هنا
ما يجب أن تعرفه عن نظرية التطور - اضغط هنا
هدم أسس الإلحاد - اضغط هنا
مدونتي - اضغط هنا
فرق ومذاهب وأحزاب وأديان معاصرة - اضغط هنا
إلى كل نصراني - اضغط هنا
فضح جهالات المدعو عمر المناصير - اضغط هنا
حقيقة المجوس الشيعة الروافض - اضغط هنا
عقد الضفيرة على شانئي أبي هريرة - اضغط هنا
الثورة المصرية .. وعقول ٌسلفية - اضغط هنا
رد مع اقتباس
  #106  
قديم 2012-08-25, 12:58 PM
عادل أحمد عادل أحمد غير متواجد حالياً
عضو جديد بمنتدى أنصار السنة
 
تاريخ التسجيل: 2012-07-26
المشاركات: 18
افتراضي

مرحباً بك أخي مرة أخرى، لقد راجعت الفصول التي أشرت لها إنت في الكتاب، واعتقد أن معك حق، يبدو أنني كنت على خطأ في الأمر منذ البداية، أكرر لك شكري مرة أخرى ونتمنى أن نتبادل حوارات أخرى مفيدة
رد مع اقتباس
  #107  
قديم 2012-08-25, 01:40 PM
أبو حب الله أبو حب الله غير متواجد حالياً
محـــاور
 
تاريخ التسجيل: 2011-10-24
المشاركات: 305
افتراضي

[align=center]
.....
[/align]
__________________


<< حضور متقطع >>
حوار مع مسلم - اضغط هنا
ما يجب أن تعرفه عن نظرية التطور - اضغط هنا
هدم أسس الإلحاد - اضغط هنا
مدونتي - اضغط هنا
فرق ومذاهب وأحزاب وأديان معاصرة - اضغط هنا
إلى كل نصراني - اضغط هنا
فضح جهالات المدعو عمر المناصير - اضغط هنا
حقيقة المجوس الشيعة الروافض - اضغط هنا
عقد الضفيرة على شانئي أبي هريرة - اضغط هنا
الثورة المصرية .. وعقول ٌسلفية - اضغط هنا
رد مع اقتباس
  #108  
قديم 2012-08-29, 04:03 PM
أبو حب الله أبو حب الله غير متواجد حالياً
محـــاور
 
تاريخ التسجيل: 2011-10-24
المشاركات: 305
افتراضي

[align=center]
أحترم تراجعك أخي عادل ...
وأنت الآن تعلو منزلة ًفي نظري ...
ووالله لا أشعر بأني أخلصت في عمل لله : إلا عندما أعتذر عن خطأ !
والله المستعان ..
ويجمعني وإياك على الخير بإذن الله ..
[/align]
__________________


<< حضور متقطع >>
حوار مع مسلم - اضغط هنا
ما يجب أن تعرفه عن نظرية التطور - اضغط هنا
هدم أسس الإلحاد - اضغط هنا
مدونتي - اضغط هنا
فرق ومذاهب وأحزاب وأديان معاصرة - اضغط هنا
إلى كل نصراني - اضغط هنا
فضح جهالات المدعو عمر المناصير - اضغط هنا
حقيقة المجوس الشيعة الروافض - اضغط هنا
عقد الضفيرة على شانئي أبي هريرة - اضغط هنا
الثورة المصرية .. وعقول ٌسلفية - اضغط هنا
رد مع اقتباس
  #109  
قديم 2012-08-29, 04:04 PM
أبو حب الله أبو حب الله غير متواجد حالياً
محـــاور
 
تاريخ التسجيل: 2011-10-24
المشاركات: 305
افتراضي

متفرقات ...
نسف شبهة التحام الكروموسوم 2 أثناء تطور الإنسان من سلف القرود !!..

وهي شبهة يتداولها الملاحدة كثيرا ً.. ويلوكونها - كعادتهم - في كل حوار يريد الجهبذ منهم إثبات أحد أدلة التطور ( الدامغة ) !!!..
وذلك كما سترون في المشاركة القادمة لنسف شبهة العصب الحنجري في الزرافة أو غيرها من الكائنات الفقارية ..

ولعل العامل المشترك بين تلك الشبه جميعا ً: هي أنها لا تنطلي ولا تمر إلا على جاهل بعلومها أصلا ً: سواء علوم التشريح أو البيولوجيا الجزيئية إلخ ..
فأما المسلم :
فيحترم جهله بما لا يعلمه .. ولكنه على يقين من ربه : فينتظر ظهور الحق أو يسأل ..
وأما الملحد :
فيتبختر بجهله على غيره إلى أن يصدمه الله تعالى بالحقيقة المرة :
فيختفي ساعتها الملحد ويهرب :
ليبدأ رحلة بحثه عن شبهة ساقطة جديدة يتمسك بها لعلها تعطيه بعض التبرير لكفره بالله عز وجل خالقه !!..

لن أطيل عليكم ...
وكعادتي : فسوف أعطي مقدمة ومعلومات عن موضوع الشبهة : وحتى يستطيع الكل - مسلم وملحد - أن يعرف عما نتحدث :
ويكتشف بنفسه سماجة أفكار الملاحدة وتفاهتها عندما يعلم الجمهور بحقائق ما يتحدثون عنه !!!..
---------

1...
التطوريون كلهم غشاشون وكذابون ومخادعون وبكل جراءة ( هذه قاعدة لا تنسوها أبدا ً)

2...
وليس لهم إلا الفرضيات والخيالات والسيناريوهات المضحكة لتفسيراتهم المتعلقة بالتطور ...
وأغلبها يعتمد على التشابه الشكلي (الخارجي) للكائنات الحية !!!..

يعني لتقريب الفكرة مثلا ً( وأرجو عدم الضحك ) :
لديهم الغش في رسم وتخيل وافتراض الأشكال البينية بين أي حيوانين لتفسير التطور :



مثال :
من سمكة بحرية إلى ضفدع برمائي (وبقدرة قادر !) إلى سحلية زاحفة : إلى أرنب ثديي !!
وكما في الصورة التالية :



ولديهم القدرة أيضا ًما شاء الله على التخيل في الاتجاه المعاكس (أي من البر إلى البحر) !
من دب يسبح : إلى حوت يفوقه عشرات المرات في الحجم !!.. ويختلف عنه تماما ًفي البنية !



أو حتى مثل هذه من الديناصورات إلى الطيور (بقدرة قادر !) :



أو حتى من سمكة الكوالاكينت إلى تمساح !!!..



وأخيرا ً( ولاحظوا شدة التشابه هذه المرة ) :

بين الشيمبانزي :



وابن عمه - في دينهم - : الإنسان !!!..



وبغض النظر عن استحالة ذلك فسيولوجيا ًوعلميا ًومنطقيا ًوتميز الإنسان الشديد !
http://abohobelah.blogspot.com/2012/06/1.html



وبغض النظر عن فضائح غشهم وخداعهم المتتالية بشأن الحفريات البينية :
سواء للإنسان :
http://abohobelah.blogspot.com/2012/06/1.html

أو غيره مثل الحيتان والتي وضعوا لها زيادات غير حقيقية في متاحف التطور وباعترافهم !
http://abohobelah.blogspot.com/2012/06/6_9100.html

وهكذا نجد كذباتهم : لازالوا يستبقونها في كتبهم ومواقعهم وحتى الويكيبديا : بغير حياء !...

3...
وعندما انهارت أحلامهم على عتبة البيولوجيا الجزيئية وحقائق الحمض النووي المذهلة DNA :
وأن لكل حيوان شيفرته الوراثية المميزة داخل كل خلية من خلاياه :
لم ييأسوا !!!!..
< يعني يضيع الإلحاد يعني ولا إيه ؟!!.. >

ولكن قرروا استغلال السلاح القاتل الذي عليهم : لصالحهم !!!..

فماذا قرروا ؟!!!..

لقد نظروا بالطبع على أعلى قضاياهم أهمية في الكفر والإلحاد وهي الإنسان وابن عمه الشيمبانزي :
واللذان ينسباناهما لجد ٍواحد وأصل واحد مشترك في زعمهم ...
فماذا واجدوا ؟!!!..

نظروا في جدول عدد كروموسومات الكائنات الحية (ليس كلها بالطبع ولكن عددا ًمنها) ...
< وتسمى الكروموسومات بالصبغيات : لأن العلماء لما يريدون رؤيتها داخل الخلية المعقدة يصبغونها لتمييزها >



فالصورة أعلاه تبين زوجين من كل كروموسوم ...
(في خلايا الجسد 46 زوج كروموسوم وفي الخلايا الجنسية 23) وإليكم التفصيل :



حيث الكروموسوم أو الصبغي الواحد : هو شكل الـ X التي ترونه في الصورة أعلاه .. ويتكون الصبغي الواحد من زوجين من الكروماتيد : مشدودان من المنتصف تقريبا ًوهو ما يعطي للكرومسوم شكل الـ X المميز ولكنهما غير متقاطعتين .. وتحتوي خلية الإنسان الجسدية على 46 زوج (آخر زوجين هما الكروموسومين الجنسيين : xx في حالة الأنثى و xy في حالة الذكر) .. وتتفاوت الكروموسومات في الطول والشكل إلى أربعة أنواع رئيسية : وكما هو مشروح في منتصف الصورة .. ولكل كروموسوم ذراع قصير (يرمزوا له بـ p) وذراع طويل (q) ..

أقول : فلما نظروا في جدول عدد كروموسومات تلك الكائنات الحية :



وجدوا (وكما ترون في أسفل يمين الصورة أعلاه : الشيمبانزي والإنسان) :
وجدوا الشيمبانزي يملك في خلاياه : 48 كروموسوم .. والإنسان يملك : 46 ..!!
يبقى بس .. اتحلت ...

ده شبه ده !!!.. < وبنفس منطق الصور التطورية الخرافية التي سقتها لكم بالأعلى >

ونسي الجهابذة أن المسألة لو بعدد الكروموسومات :
فنبات البطاطا يملك 48 كروموسوم مثل الشيمبانزي !!.. فهل البطاطا شبهنا برضه أو حتى شبه الشيمبانزي ؟!
وأحد أنواع الأرانب (jack rabbit) لديه أيضا ً48 كروموسوم مثل الشيمبانزي : فهل يشبهنا أيضا ًأو يشبه الشيمبانزي ؟!
بل - ودعونا من عدد الـ 48 كروموسوم : وخلينا في عدد يطابق عدد كروموسوماتنا الـ 46 - :
فأحد أنواع الغزلان (Reeves's Muntjac) يملك مثلنا عدد 46 كروموسوم !!.. فهل يشبهنا ؟!!!..
وكذلك أحد أنواع الظباء (Sable) : لديه 46 كروموسوم مثلنا !!.. فهل يشبهنا أو ابن عمومتنا هو أيضا ً؟!!..

معضلة .. صح ؟؟..

ومن هنا ...
لجأ الملحدون في حربهم هذه التي لا استسلام فيها مهما انفضحوا : لجأوا للعبة جديدة وهي :
تشابه الجينات !!!..

فبالطبع لا يعني أن عدد كروموسومات نبات البطاطا 48 وتساوي عدد كروموسومات الشيمبانزي :
أنهما متشابهين جينيا ً!!.. لا بالطبع ... ولا يعني حتى أنها قريبة من الإنسان 46 كروموسوم ..
وذلك لتفاوت طول وعدد جينات كل ٍمن كروموسومات نبات البطاطا : والإنسان أو الشيمبانزي بالمقابل !!..
ولكن :
أرادوا أن يبرهنوا على التقارب بين جينات الإنسان والشيمبانزي أكثر وأكثر ...
فماذا فعلوا ؟!!!..

لجأوا إلى خدعتين ...
الأولى - وهي ليست أصل موضوعنا الآن ولكن سنذكرها - :
وهي ادعاءهم تشابه جينات الإنسان والشيمبانزي بنسبة 98.5 % !!!!..
وهذا الإعلان وحده - وعلى عموميته هكذا - كفيل بخداع وبلبلة أي أحد من محاربي التطور !!!..
ولكن : هل يعني ادعاؤهم ذلك أي شيء بالفعل على أرض الواقع علميا ً؟!!!..

نقول ...
أولا ًتشترك الكائنات الحية في الكثير جدا ًمن الصفات الحيوية .. مما يجعل نسبة تشابه كبيرة في الجينات - فالغزال فعلا ًيلد مثلنا ويأكل ويتنفس ويجري وله قلب وله معدة ورئتين إلخ - ومن الجهة الأخرى : فعدد كبير جدا ًمن جينات الحمض النووي : لها وظائف متشابههة في انقسام الحمض النووي ونسخه وترجمته لبروتينات إلخ .. وهي وظائف واحدة في كل الكائنات الحية أيضا ً!!!.. وهي التي كانوا يسمون معظمها من قبل جانك جين : أي جينات بلا فائدة : عندما لم يكونوا اكتشفوا وظائفها بعد !..
فهذا كله يجعل بالفعل : تقارب كبير بين جينات الكائنات الحية ...

ولكن ... لماذا الإنسان والشيمبانزي بالذات أعلنوا عنهما هذه النتيجة الغريبة ؟!!..
وهل بالفعل تلك النسبة الـ 98.5 % : هي لكل جينات الإنسان والشيمبانزي ؟؟.. أم جزء منها فقط ؟!!..

4...
نقول (وكما نقل لنا الدكتور السرداب جزاه الله خيرا ً) :
في عام 1987 قام عالمان داروينيان وهما : سيبلي Sibley و : ألكوست Ahlquist :
بدراسة 30-40 حمض أميني في الشمبانزي : ومقارنتها بتلك الموجودة في الإنسان ..
ثم خرجوا بنتيجتهما المتحيزة - والتي لم تتزعزع من ساعتها إلى اليوم في الأوساط الداروينية والإلحادية - :
وهي أن نسبة التشابه في الجينـات بين الإنسان والشيمبانزي هي 98.5 % !!!..
ثم قاما بنشر بحثهما في مجلة داروينية شهيرة !!!..
Sibley and Ahlquist, Journal of Molecular Evolution, vol. 26, pp. 99-121

لكن المثير للجدل في هذا الأمر : هو أن تلك الدراسة قديمة منذ عام 1987 :
ولم يكن أحد بعد قد استطاع رسم خريطة الجينوم البشري بأكمله والتي لم تنته إلا 2001 !!..
فعلى ماذا خرجوا بهذا التعميم من تشابه (( جينات )) البشر والشيمبانزي بـ 98.5 % ؟!!..
وخصوصا ًوأن علماؤهم كانوا يقولون أن المناطق التي تحتلها الجينات على شريط الـ DNA :
هي 5 % فقط !!.. وباقي الـ 95 % كانوا يصفونها بالجانك جين أي جينات متخلفة من التطور :
ثم اتضح أن لها وظائف هامة جدا ًكما وضحنا هنا :
http://abohobelah.blogspot.com/2012/06/6_7828.html

ثم :
وما هي نسبة 30 أو 40 .. إلى 100 ألف حمض أميني أو بروتين في خلية الإنسان !!!..
بمعنى آخر : نسبة ما قاموا بمقارنته هو 1 : 2500 !!!!!!!!!!!!!!!!!!!..
وهو ما لا يتم ذكره لدى الملاحدة ومروجي التطور عند إعلانهم هذا الخبر الساحق الماحق :
نسبة تشابه جينات الإنسان والشيمبانزي : 98.5 % !!!..
< دوما ًهم يتفننون في صنع أخبار الاكتشافات والأبحاث وعناوينها الخادعة كما رأينا من قبل >

وليس هذا فقط .. بل إن التجربة التي استخدمها العالمان : هي تجربة قليلة الاستخدام أصلا ًومثيرة للجدل !!.. ألا وهي تجربة الـ DNA التخليطي !!..
وقد قام أحد العلماء ويدعى ساريش Sarich : بإستخدام نفس التجربة على نفس البروتينات التي قام بها العالمان : واكتشف أن مصداقية أبحاثهم مثيرة للجدل هي الأخرى !!.. وأن البيانات مبالغ فيها إلى حد كبير !!!.. وأن نسبة التشابه أقل من ذلك بكثير !!!..
Sarich et al. 1989. Cladistics 5:3-32

< تذكروا : كل علماء التطور والملاحدة : كذبة أو مخادعين إلا مَن طلب منهم الحق : مثال :
http://abohobelah.blogspot.com/2012/06/blog-post.html

ومسألة المقارنة على أساس البروتينات والأحماض الأمينية أصلا ًلا ترمز إلى شيء حقيقة ًيفيد التطور !!.. لأنه من الطبيعي كما قلت من قبل أن يكون هناك نسبة تشابه كبيرة بين الكائنات : وخصوصا ًلتتكامل السلاسل الغذائية !!!..
فنسبة التشابه بين الإنسان والدجاج مثلا ًكبيرة : من بحث لجامعة كامبردج !!!..
New Scientist, v. 103, 16 August 1984, p. 19

ونسبة التشابه بين الإنسان وديدان النيماتود nematode تصل إلى 75% !!!..
وهذا حتما لا يعني أن 75% من جسد الإنسان مطابق للديدان طبعا ً!!!.. ولا يقول بذلك عاقل !!..
New Scientist, 15 May 1999, p. 27

وكذلك نسبة التشابه بين الإنسان وذبابة الفاكهة 60% !!!..
Hürriyet daily, 24 February 2000

وفي مجلة SCIENTIFIC AMERICAN الداروينية الشهيرة عدد ديسمبر 2009 :
وفي مقال بعنوان : ما الذي يجعلنـا بشرا what makes us human ؟!!..
حيث قامت الباحثة كاتبة المقال بدراسة متوالية DNA في أحد الجينـات ويُطلق عليه HAR1 ..
وقامت بدراسة هذا الجين في كل من الإنسان والشمبانزي والدجاج .. وعدد قواعده النيتروجينية 118 قاعدة ..
فاكتشفت أنه حسب النتائج :
فإن الدجاج - ومن المفترض طالما كانت المسألة بالشبه !! - فإنه أقرب للشيمبانزي من الإنسان !
حيث الاختلاف في متوالية للـ DNA الـ 118 بين الشمبانزي والدجاج : 2 فقط !
وأما بين الدجاج والإنسان : 18 !!!..



وهذا إن دل على شيء كما قلنا : فيدل على أن هذا الطريق هو الآخر :
مسدوووووووووووووووود !!!..

فهل استسلموا ؟!!!..

5...
بالطبع الإجابة معروفة .. فمسألة التطور بالنسبة لهؤلاء القوم :
هي أيدلوجية يقوم عليها إنكار الإله في العصر الحديث تحت عباءة مزورة للعلم !!!..

فماذا كان ؟!!!..

لقد رجعوا لمسألة كروموسومات الإنسان والشيمبانزي من جديد ...
ودأبوا للبحث فيها للخروج بحُجة جديدة : تساند مزاعمهم في التطور !!!..
ورغم أن علماؤهم حتى الآن - لاسيما البيولوجيين منهم - :
لا زالوا يتخبطون في محاولة تفسير كيفية ظهور طفرات كبيرة بالصورة التي تنتج للكائن أعضاء جديدة ومهيأة تماما ًلوظيفتها في بيئته :
إلا أنهم افتروا هذه المرة فرية كبيرة !!!..
ما كانوا ليتجرأوا عليها إلا مستغلين جمود فكر أتباعهم عن البحث والاعتراض !!..
فضلا ًعن ندرة التخصص الذي يتحدثون فيه (عالم الـ DNA) بين العوام !!!..
فماذا كان مخرجهم الذي يتشبثون به ويبثونه في كلامهم ومواقعهم وحتى في الويكيبديا للأسف ؟

6...
في الرابط التالي الذي يشير إليه الملاحدة والتطوريون كثيرا ً:
معلومات عن أحد كروموسومات الإنسان : حيث قامت الويكيبديا بعرض نبذة عن كل كروموسوم :
وهذا الذي ربطوه بالتطور : هو الكروموسوم رقم 2 هنا :
http://en.wikipedia.org/wiki/Chromosome_2_(human)

حيث أفردوا له - وكعادتهم في الويكيبديا - فقرة كاملة عن علاقته بالتطور !!!..

حيث يقولون أن عدد كروموسومات الشيمبانزي الـ 48 مثل سلف الإنسان المزعوم :
قد التحم منها كروموسومان ( كده بقدرة قادر ) أثناء تطور الإنسان خصوصا ً:
ليصبح عدد كرومسومات الإنسان 46 فقط !!!!..

فيتحدثون عن ذلك بكل بساطة : وكأن مسألة فك والتحام كرومسومات الـ DNA هذه :
هي في مثل سهولة عملية لحام الحديد أو المعادن !

والواقع :
أن أي نظر في عالم الـ DNA - وكما سنفعل الآن - : هو ينزع من أي إنسان اعترافا ًيقينيا ًبأنه هناك : فاعل مدبر خالق حكيم : هو الذي يهدي هذه المكونات المتناهية في الصغر والتعقيد والنظام : إلى عملها الكامل وكما هو مخطط له ...!!
وكما أشرت هنا مثلا ً:
http://abohobelah.blogspot.com/2012/06/6_8870.html

ولنبدأ معي الآن - وكعادتي في حبي لإظهار إعجاز خلق الله قبل وأثناء الرد على الشبهة -
فأقول ...

1)) تعقيد الـ DNA كمركب بروتيني ...

يتركب الحمض النووي من 4 قواعد نيتروجينية وهي :
الثايمين T ولا يرتبط إلا بالأدنين A ..
والسايتوسين C ولا يتربط إلا بالجوانين G
وتترتب هذه القواعد على جانبي الشريط النووي الطويل في شكل تتابعات متقابلة (نيوكليدات) مثل :
CATTGTCATTGGCTATGCCATGCTTTGACGTGAGG
وهكذا .. حيث تكون كل ثلاثة منها شيفرة وراثية من شيفرات الجين ...



وتحتوي كروموسومات خلية الإنسان عدد 3.2 مليار نيوكليدة !
وكل ثلاث متتابعات كما قلنا : يمثلون شيفرة وراثية من شيفرات الجين : لتكوين بروتين معين ..
ويؤدي التغير العشوائي في متتابعة هذه الشيفرة إلى أثر يكون مؤذي ومرضي ..
مثل تغيير المتتابعة (CTC) إلى (CAC) : في الشيفرة الوراثية السادسة : والمسؤولة عن تركيب السلسلة بيتا من خضاب الدم : فينتج مرض فقر الدم لتغير البروتين الناتج : فتظهر بسبب ذلك كريات دم قابلة للتمنجل (فقر الدم المنجلي) ..
وكل مجموعة كبيرة من هذه الشيفرات الوراثية : تعطي جينا ًكما قلنا يختلف طوله بمستوى تعقيده ..!
< يحوي الكرومسوم الواحد : من مئات إلى آلاف الجينات على حسب طوله >

وأما الإعجاز في لف كل هذه الكروموسومات الدقيقة داخل نواة الخلية الواحدة من جسم الإنسان :
فانظروا معي للإبهار التالي :
ويا ليت تبدأوا معي من أسفل الصورة إلى أعلاها ..
حيث نبدأ في الأسفل بصورة حقيقية لكرومسوم على اليمين : وأخرى مرسومة بسيطة على اليسار ..
ثم يتم أخذ مربع صغير من الصورة التي على اليسار لتكبيره لبيان تعقيده ...!
ثم يتم أخذ مربع منه لتكبيره أيضا ً: وبيان التفافه على الهستونات المكورة كما في الصورة ..!
ثم تكبيرها بمربع آخر ..
ثم أخذ مربع صغير منها لتكبيره : لنحصل أخيرا ًعلى شريط الحمض النووي من النيوكليدات !
فسبحان الله العظيم على مَن يصف كل ذلك بالصدفة والتطور : أخزاهم الله !



7...
والآن نرجع لأصل الشبهة .. ومن موقع الويكيبديا ..
حيث أوردوا الصورة التالية : لتوضيح تخيلهم لالتحام زوج الكروموسوم المزعوم :



فماذا نرى في الصورة أعلاه ؟؟؟..
الشكل على اليمين :
نرى تخيلهم لكرومسومين للشيمبانزي : وقد التحما معا ًفي الكرومسوم 2 للإنسان !
وأما دلالتهم المتوهمة على ذلك : فهي وجود هذه البقايا الزرقاء والحمراء في الكرومسوم 2 :
حيث يشرحها المستطيل الذي على اليسار :
بأن اللون الأزرق :
يرمز إلى السنترومير : وهو الجزء من الكروموسوم الذي يربط نصفيه الكروماتيدتين معا ً..
وهو الذي يسبب الاختناق والضيق في منتصف شكل الكرومسوم ويعطيه شكل X المميز ..
وأما اللون الأحمر :
فيرمز إلى التيلوميرات .. وهي غطاء غلق أطراف الكرومسوم في نهايتي كل كروماتيدة ..
ويشبهها العلماء بالقطعة المعدنية في نهاية رباط الحذاء لحمايته ..
وإليكم الصورة التالية فيها شرح أكبر للسنترومير والتيلوميرات وغيرها في الكروموتيدة الواحدة :



حيث نرى في الصورة أعلاه : ثلاثة أنواع من تراتيب النيوكليدات المميزة والهامة وهي :

1))
مناشئ التضاعف :Replication Origins of ..

وهي التتابعات النيوكليوتيديه المميزة التي يبدأ من عندها عملية تضاعف الـ DNA

2))
السنتروميرات Centromeres ..

(وهي مربط الفرس لدينا هنا هي والتيلوميرات فأرجو التركيز) ..
وهي تتابعات نيوكليوتيدية تتوسط الكروموسومات : وهي عالية التكرار وشديدة التعقيد :
وهي التي تشد كل كروماتيدة للداخل لتعطي الشكل المميز X للكروموسوم كما قلنا ..
وتتجسد واحدة من أكبر مهمام السنترومير أثناء انقسام الخلية والانعزال الدقيق للكروموسومات خلال الانقسام النووي (الميتوزي والميوزي)
ولذلك لو لاحظتم في الصورة أعلاه : ستشاهدون شيئا ًمرتبطا ًبالسنترومير وهو :
>>>
بروتين الكينيتوكور Kinetochore proteine ..
وهو مجموعة من البروتينات الخلوية التي ترتبط بالسنترومير خلال الانقسام النووي (الميتوزي والميوزي) ..

>>>>

وأما الذي يريد أن يرى جزءا ًمن الإبهار بعينيه ليقول :
سبحان الخالق : وما أغبى الملاحدة والتطوريين : فلينظر معي لمقاطع الفيديو التالية :

فهذا فيديو توضيحي لعملية الانقسام ودور السنترومير في ارتباط خيوط المغزل به وشد الكروموسومات :

[video=youtube;cvlpmmvB_m4]http://www.youtube.com/watch?v=cvlpmmvB_m4&amp;feature=player_embedded[/video]

وهذا فيديو آخر أطول وأكثر احترافية لأنه يعرض أطوارا ًأخرى أيضا ًغير الانقسام ..
وأعتذر عن الموسيقى ولكنه يستحق المشاهدة ...

[video=youtube;C6hn3sA0ip0]http://www.youtube.com/watch?v=C6hn3sA0ip0&amp;feature=player_embedded[/video]

والخلاصة نقول :
السنترومير : هو النقطة التي يتم مسك الكروموسوم منها بخيوط مغزل الخلية : للتوجيه الحركي لكل كروموسوم : للاصطفاف مع الآخرين وسط الخلية قبل الانقسام والفصل !!!.. وإليكم هذا الفيديو الأخير يشرح المسألة بصورة أكاديمية مبسطة ومفصلة لمَن يفهم اللغة الإنجليزية :

[video=youtube;jvJw_TZjjlw]http://www.youtube.com/watch?v=jvJw_TZjjlw&amp;feature=player_embedded[/video]

والسؤال الآن لكل مَن لا زال يصدق خرافات التطور :
هل يبدو هذا السنترومير هو من الأشياء التي يسهل تكرارها داخل الكروماتيد الواحد وكما يدعون في كروموسوم 2 في الإنسان ؟!!..
هل تخدعكم هذه الافتراضات الساذجة - كالمعتاد - للتطوريين ورسمتهم هذه في الويكيبديا :



هل تصدقون تعليقاتهم عليها : وبعد كل ما شاهدتموه من قمة في التخطيط (أو الهداية الربانية كما نسميها) والنظام والترتيب والتعقيد في كل جزء وتكاملهم جميعا ًلغايات وأهداف محددة ؟!!..
بل ...
هل تعلمون أن منطقة هذا السنترومير هي من أعقد البروتينات في الكرومسوم ومن أكثر أعداد تتابعاته تكرارا ً..
وانظروا معي للصورة التالية :
ويظهر فيها بجلاء شدة تعقيد السنترومير في الوسط أو التيلوميرين في الأطراف :



فهل من العقل أن يُقال أن هناك (( بقايا )) سنترومير في الكرومسوم 2 في الإنسان ؟!
هل يوجد تعقيد في تلك (( البقايا )) مثلا مثل تعقيد السنترومير الأصلي الموجود به فعلا ً؟!!..
هل الخلية تتخبط وتتلخبط في إرسال خيوطها المغزلية مثلا ًعند انفصال الكرومسومات :
فتمسك بهذه (البقايا) بدلا ًمن السنتروميرات الأصلية ؟!!..
أم هل يوجد عند هذه (البقايا) بروتين الكينيتوكور : وكما في السنترومير الحقيقي ؟!!..
أم أن الأمر مجرد (( تشابه ظاهري )) كعادة التطوريين والملاحدة دوما ً:
حيث وجدوا تشابها ًبين مجموعة متتابعات في الكرومسوم 2 : ومتتابعات السنترومير المتكررة ؟!!..
والله المستعان ...!

وأما التيلومير .. فالأمر أعقد وأغرب !!!.. وأعجز للملاحدة ؟!!..
لأنه الجزء الخاص في الكروموسومات أصلا ًلحمايتها من الإلتحام !!!.. فهذه من أبرز وظائفه !

4))
التيلوميرات : Telomeres ..
فالتيلوميرات هي تتابعات متخصصة من الـ DNA توجد عند نهايتي كل كروماتيدة في الكروموسوم ..
< يعني 2 في الكروماتيدة الواحدة عند طرفيها - 4 في الكروموسوم الواحد >
ولهذه التتابعات عدة وظائف منها (وأرجو الانتباه الشديد) :

1-
تسهيل عملية تضاعف نهايات الكروموسومات : وضمان عدم قصرها عند كل دورة تضاعف ..
2-
منع التحام نهايات الكروماتيدات مع بعضها البعض أثناء الانقسام (وهذه هامة جدا ً) !
3-
منع الإنزيمات المحللة للدنا من تكسير نهايات الكروماتيدة ..

ولكي أختصر عليكم الفهم .. وفي ضوء ما تم منحه من جائزة نوبل عام 2009م لثلاثة باحثين ودكاترة بخصوص وظيفة هذه التيلوميرات وإنزيمها : وبخصوص أيضا ًأحدث النتائج عام 2011 :
فهذه التيلوميرات : تعتبر المؤشر الأبرز اليوم على عمر الخلايا وعمر الإنسان بالتالي !!..
وسأقوم بتيسير الفهم عليكم أكثر ...

فهذه التيلوميرات في نهاية الكروماتيدات : لها تتابع طويل ...
ومع كل عملية تضاعف في كرومسومات الخلية : تفقد هذه التيلوميرات من طولها ..
حتى تصل إلى حد معين من القصر : لا تستطيع معه حماية الكروماتيد عندها .. فيبدأ موت الخلايا أو نهايتها !
ومن هنا يستطيع العلماء النظر في طول هذه التيلوميرات : ومقارنتها بعمر الإنسان !!..

فالطفل مثلا ً: تكون التيلوميرات في نهايات كرومسوماته طويلة ..
وكلما تقدم به العمر : تزداد قصرا ً...

< حيث في الخلايا الجسدية العادية : يتم فقد طول معين من تتابعات التيلوميرات عند كل تضاعف :
وأما في الخلايا الجنسية : فلا !!.. وذلك ليولد الجنين بتيلوميراته كاملة كما هو مفترض !!..
فسبحان مدبر كل شيء وهاديه
> !!!..

وهذا لا يعني أن العلماء يستطيعون الآن أن يحددوا عمر الإنسان .. لا ..!
وإنما مثلا ًإذا رأوا تلك النهايات (أي التيلوميرات) قصيرة عند طفل وعلى عكس المفترض :
فيعرفون أن عمره لن يطول .. لأنه لن يلبث طويلا ًحتى تنتهي خلاياه ...
وكذلك لو كان هناك رجل أو شاب : طول تيلوميراته أقصر من المفترض لمثل سنه :
يُعلم أن هناك قصر في عمره ... وهكذا ...

ولقد بدأت بعض الشركات عالميا ًبالفعل في تقديم هذا الاختبار النووي .. ولكن تكلفتها لا زالت كبيرة الآن .. ويتوقعون مع زيادة الإقبال عليها وانتشارها - وخصوصا ًمن شركات التأمين على الحياة المحرم شرعا ً- أن تقل تكلفتها ...

وإليكم هذا الفيديو التوضيحي القصير عن التيلوميرات وإنزيمها لحماية أطراف الكرومسومات .. وقصرها مع كل عملية تضاعف :

[video=youtube;qQCecSuPa1w]http://www.youtube.com/watch?v=qQCecSuPa1w&amp;feature=player_embedded[/video]

وهذا فيديو آخر أكثر طولا ًوشرحا ًوتفصيلا ًولكن لمَن يفهم اللغة الإنجليزية :

[video=youtube;8EUbJW-38qQ]http://www.youtube.com/watch?v=8EUbJW-38qQ&amp;feature=player_embedded[/video]

فموضوع التيلوميرات طويل ومعقد وهام جدا ًعندما فكر العلماء في استغلاله !!..
وخصوصا ًللتحكم في تضاعف الخلايا السرطانية مثلا ً!!!..
وكما ستشاهدون أو تقرأون في الفيديو أعلاه ...
----------

وأخيرا ً....
هل ما زلتم ترون أية حيادية في بقاء هذه الكذبة الإلحادية والتطورية في موقع الويكيبديا عن الالتحام المزعوم في الكرومسوم 2 : والتي تم وضعها فيما يبدو منذ سنوات : وقبل هذا التداعي المتسارع في الاكتشافات المتعلقة بالتيلوميرات وغيرها ؟!!!..

تلك التيلوميرات الموجودة أصلا ًلـ (( منع التحام )) نهايات الكروموسومات بعضها ببعض !!..
فتصبح عند التطوريين والملاحدة ( وبقدرة قادر ) : تسمح بهذا الإلتحام بل : وتقبع بقاياها بداخله !!!..

فإذا قال أحدهم أن هناك نقطة أخرى وهي قولهم أن هذا الكرومسوم 2 في الإنسان : يتشابه بالفعل جينيا ًمع كروموسومين من الشيمبانزي : لقلنا : هات الدليل الرسمي بالتتابعات الجينية ؟!!!.. لأن مثل هذا القول الجزافي : يصعب قوله هكذا بغير تحقق أصلا ً!!..
وذلك لأن معظم أبحاث المقارنات : تتم أساسا ًعلى أجزاء صغيرة من الكرومسوم وليس كله !!..
< فجينوم الشيمبانزي لم يتم رسم خريطته كله بعد مثل الإنسان والذي أخذ سنوات طويلة ! >

ثم :
وهل ما زال أحد يصدق أن الاختلاف بين الإنسان والشيمبانزي :
هو فقط بهذه التفاهة الصغيرة ؟!!..
وهل لو قمنا معمليا ًبعمل ذلك الالتحام لكروموسومي الشيمبانزي : هل سيصير أقرب للإنسان مثلا ً؟!
هل ما زال أحد يصدق هذه الخرافات بغير تعقل !!!..

أقول ذلك إخواني والله : من غمي وحزني على الإنسان عندما يبيع عقله للجهل والأوهام !!..
لأن المضحك المبكي والذي أختم به حقا ًمعكم الآن :
فهو أن الطفرات في الجينات فقط بل وفي أصغر شيفراتها الوراثية : تؤدي لاختلالات وأمراض !
فما بالنا بنقص كروموسوم بأكمله !!!.. أو زيادته !!.. أو التحامه بغيره - بفرض إمكانيته أصلا ً- !
أقول :
لقد أعطانا الله تعالى الجواب على ذلك في شكل تشوهات العيوب الولادية لمثل تلك الحالات !!!..
فهل تعرفونها ؟؟؟؟..
< سأضع بين قوسين رقم الكروموسومات الزائد أو الناقص عن العدد المفترض للإنسان وهو 46 >

تشوهات متلازمة إدوارد Edward Syndrome : بسبب نسخة زائدة من الكروموسوم 18 (47) !!!..
تشوهات متلازمة داون Down Syndrome : بسبب نسخة زائدة من الكروموسوم 21 (47) !!!..
تشوهات متلازمة باتاو Patau Syndrome : بسبب نسخة زائدة من الكروموسوم 13 (47) !!!..
تشوهات متلازمة تيرنر Turner Syndrome : بسبب نقص كروموسوم (X) للأنثى (45) !!!..
تشوهات متلازمة كلاينفلتر Klinefelter syndrome : زيادة كروموسوم (X) للرجال (47) !

وأما باقي تشوهات المتلازمات الناتجة عن طفرات أو نقص في الجينات :
فيمكن معرفة معلومات عن أغلبهم من الرابط التالي :
http://www.caihand.org/amm.htm

وأعتذر عن أي خطأ كتابي في المصطلحات لاجتهادي لعدم التخصص ..
ولكني آمل أني وضحت لكم ما يفيدكم في فهم ألاعيب التطوريين ...
ويمكن أن تفيدنا الأخت طالبة علم وتقوى من واقع تخصصها في الييولوجيا الجزيئية بما يفيدنا أيضا ً..
أو تصحح لي خطأ أو تعيد توجيهه علميا ً...

والله المستعان ...

__________________


<< حضور متقطع >>
حوار مع مسلم - اضغط هنا
ما يجب أن تعرفه عن نظرية التطور - اضغط هنا
هدم أسس الإلحاد - اضغط هنا
مدونتي - اضغط هنا
فرق ومذاهب وأحزاب وأديان معاصرة - اضغط هنا
إلى كل نصراني - اضغط هنا
فضح جهالات المدعو عمر المناصير - اضغط هنا
حقيقة المجوس الشيعة الروافض - اضغط هنا
عقد الضفيرة على شانئي أبي هريرة - اضغط هنا
الثورة المصرية .. وعقول ٌسلفية - اضغط هنا
رد مع اقتباس
  #110  
قديم 2012-09-04, 09:26 AM
أبو حب الله أبو حب الله غير متواجد حالياً
محـــاور
 
تاريخ التسجيل: 2011-10-24
المشاركات: 305
افتراضي


متفرقات ...
بعض روابط الموضوع لكشف كذب وخداع وتدليس التطوريين في أدلتهم ..

الأخوة الكرام ...
أعلم أن المشاركات المتعلقة بالتصميم الذكي كما وعدتكم تأخرت .. ولكن والله ما باليد حيلة ..
هو الانشغال وضيق الوقت << عدوي اللدود ... وإلى أن تحين فرصة الكتابة :
سأنقل لكم إجابة شبهتين يظهر فيهما كذب وتدليس التطوريين من جديد ..
الأولى بخصوص العصب الحنجري وخاصة ًفي الزرافة ..
والثانية بخصوص التطور المزعوم لإحدى سحالي أوروبا (سحلية الحائط الإيطالية) ..

ولكن قبل البدء في عرض الرد على الشبهتين ...
سأستعرض معكم أولا ًنصيحتي لأحد المنخدعين بهؤلاء القوم الكذابين - أكثرهم ملاحدة - ..
حيث قلت له :
-----------

بداية ًزميلي :
أدعو الله عز وجل أن تكون ممَن يبحثون عن الحق فعلا ًولست متصفا ًبالعناد ولا الهوى ...
فإن كنت كذلك : فأبشر بالخير إن شاء الله ...

وكعادتي في كل رد :
سأضع الرد في نقاط متسلسلة لسهولة قراءته ومتابعته ...
فأقول والله المستعان :

1...
الذي يعلم بأن التطوريين مجموعة من الكذابين والمخادعين : فالمفترض ألا يثق بهم .. ولا بعروضهم التليفزيونية ومجلاتهم العلمية إلخ ..
فما أسرع ما يدندنون حوله اليوم : ثم تنفضح كذباتهم غدا ً!!!..
وإن كنت لا تعلم مدى جرأتهم على الكذب وغش الناس والعوام وانعدام أمانتهم العلمية في ذلك - وهي علامات الباطل وإلا ما كانوا لجأوا لكل هذه الحيل - : فإن كنت لا تعلم ذلك : ولم تقرأ عنه من قبل :
فإليك هذه الروابط فيها عشرات من أنواع الكذب الذي يتغذون عليه ولا حياة لنظريتهم وانطلاءً لها على العوام بدونه :

لماذا يكذب التطوريون دوما ً؟؟
http://abohobelah.blogspot.com/2012/06/4.html

كيف انتقلت الأسماك إلى البر (ومعها فضيحة أكذوبة سمكة الكوالاكينت) :
http://abohobelah.blogspot.com/2012/06/5.html

أكاذيب إمكانية تطور الإنسان من سلف أشبه بالقرود :
http://abohobelah.blogspot.com/2012/06/1.html

أكذوبة تطور الجنين البشري مرورا ًبمراحل تطوره في الرحم !!..
http://abohobelah.blogspot.com/2012/06/blog-post.html

فضائح أكاذيبهم في إيجادهم حفريات أصل الإنسان أو الحلقات الانتقالية :
http://abohobelah.blogspot.com/2012/...g-post_20.html

تفريغ فيلم المطرودون الذي فضح تكميم الأفواه في الخارج لكل مَن ينتقد التطور من دكاترة الجامعات :
http://abohobelah.blogspot.com/2012/06/6_4265.html

فضائح أكاذيبهم وفي مجلاتهم العلمية عن تطور الطيور من الديناصورات !
http://abohobelah.blogspot.com/2012/06/6_9827.html

فضائح أكاذيبهم عن تطور الحيتان والدلافين من كائنات برية واعتراف مدير متحفهم بذلك :
http://abohobelah.blogspot.com/2012/06/6_9100.html
وهذا معه :
http://abohobelah.blogspot.com/2012/...g-post_21.html

أكذوبة أن التهجين هو التطور الأصغر ويمكن أن يؤدي إلى تطور أكبر :
http://abohobelah.blogspot.com/2012/06/6_4690.html

أكذوبة الأعضاء الضامرة : نتوء الأذن :
http://abohobelah.blogspot.com/2012/06/6_5172.html

أكذوبة الجينات التي ليس لها فائدة (الجانك جين) :
http://abohobelah.blogspot.com/2012/06/6_7828.html

وأيضا ًادعاؤهم أن الريتروفيروس دليل ٌعلى التطور :
http://abohobelah.blogspot.com/2012/06/6_5712.html

وادعاءهم وجود بقايا ذيل ضامرة للإنسان :
http://abohobelah.blogspot.com/2012/06/6_8564.html

وشبهاتهم في وجود حلمات ثدي لذكور الثدييات والرجال :
http://abohobelah.blogspot.com/2012/06/6_4900.html

وادعاؤهم بعدم وجود فائدة لأعين سمك الكهوف :
http://abohobelah.blogspot.com/2012/06/2_3272.html

وادعاؤهم عدم وجود فائدة لأجنحة الطيور التي لا تطير :
http://abohobelah.blogspot.com/2012/06/3_461.html

وخرافاتهم حول تطور عنق الزرافة :
http://abohobelah.blogspot.com/2012/...g-post_31.html

وأخيرا ً: بيان تأثر داروين بالأفكار الخاطئة في عصره وإقامته نظريته عليها :
http://abohobelah.blogspot.com/2012/...g-post_21.html

وإليك اختصارا ً: رابط مواضيع التطور بأكملها : يمكنك التجول فيها وقتما تشاء :
http://abohobelah.blogspot.com/2012/...g-post_28.html

والله الموفق ...

__________________


<< حضور متقطع >>
حوار مع مسلم - اضغط هنا
ما يجب أن تعرفه عن نظرية التطور - اضغط هنا
هدم أسس الإلحاد - اضغط هنا
مدونتي - اضغط هنا
فرق ومذاهب وأحزاب وأديان معاصرة - اضغط هنا
إلى كل نصراني - اضغط هنا
فضح جهالات المدعو عمر المناصير - اضغط هنا
حقيقة المجوس الشيعة الروافض - اضغط هنا
عقد الضفيرة على شانئي أبي هريرة - اضغط هنا
الثورة المصرية .. وعقول ٌسلفية - اضغط هنا
رد مع اقتباس
  #111  
قديم 2012-09-04, 09:35 AM
أبو حب الله أبو حب الله غير متواجد حالياً
محـــاور
 
تاريخ التسجيل: 2011-10-24
المشاركات: 305
افتراضي

متفرقات ...
شبهة العصب الحنجري في الفقاريات وخاصة الزرافة !!..

وأصل الشبهة تقدم بها أحد الزملاء الملاحدة ..
متأثرا ً- ومصدقا ً- لأحد فيديوهات البهلوان ريتشارد دونكي ...
ذلك الذي لم يعد يستحي من أي امتهان للعلم - عيني عينك - فقط لإطالة بقاء الروح في شبهات التطور التي باتت تتساقط الواحدة تلو الأخرى في انهيار متسارع يوحي أنه الأخير بإذن الله تعالى !!!..

لن أطيل عليكم ..
تقدم الزميل الملحد بالفيديو الذي يقف فيه داوكينز مع إحدى متخصصات التشريح أمام عنق الزرافة الطويل : ليقول لنا أن العصب الحنجري المتفرع من العصب الحائر أو المبهم : ينزل من المخ إلى القلب : ثم يصعد مرة أخرى إلى الحنجرة : في دورة : لا فائدة منها وإنما : هي من بقايا التطور منذ الأسماك !!!..
وتعالوا نقرأ معا ًالرد لنفهم أكثر ...
وعلى بركة الله ...
-------

1...
زميلي ...
لا يلعب داوكينز وأمثاله : إلا على العوام ومَن لا يستطيعون فهم تفاصيل ما يقول : أو حتى ليست لديهم ملكة البحث والتقصي عنه !!!..
ومن هنا :
فالكلام الذي تسمعه أنت وتفهمه ويترجمه عقلك لمعاني حسب خيالك : ليس بالضرورة يُعد (صدمة) كما تتوقع لغيرك !!!!..
حيث غيرك هذا قد يكون له من العلم أو القدرة على التقصي وتتبع الحقائق : ما ليست لك ..
ولأعطيك مثالا ً:
وقد فضلت بسببه تأخير ردي عليك لما لا يقل عن الساعة :
وحتى لا تجد فرصة ًلتغيير كلمتك فيه حيث قلت أنت :

اقتباس:
ولاكن الادهى من ذالك ان هذا العصب كان في اسلاف الاسماك البدائيه بحيث كان يلف حول القلب ويرجع للحنجره وبعد التطور بين الاجناس بقي نفس العصب يتبع نفس الاسلوب وفي كل مره اخذ يطول اكثر واكثر لان القلب اصبح الى اسفل اكثر حتى وصل للزرافه بحيث اصبح هذا العصب اطول ما وصل اليه في عمليه التطور.
حيث في ضوء كلامك أعلاه : وما لونته لك باللون الأحمر :
فهل ترى إلى أي مدى انطبعت معاني وإيحاءات زائدة من عندك : نتيجة تأثرك بما ألقاه الكذابون عليك وأوحوا به لخيالك ؟!!!..
إذ السؤال زميلي هو :
من أين جئت في هذه الفرية بأن تلك الأسماك كانت أعصابها تلف حول القلب ثم تعود إلى :
الحنجرة !!!!!!...

فهل كان لها حنجرة ؟!!!..
أترك لك الإجابة .. ولعله سبقك قلمك إذا أحسنا الظن بك وبثقافتك واطلاعك ..
أو أنك لم تنقل كوبي وبيست مضبوط من أقوال التطوريين والملاحدة ..!
حيث بدلا ًمن الحنجرة التي ذكرتها أنت هنا : هم يذكرون الخياشيم !!!..
هذه واحدة ...

2...
وأما الثانية والتي تدل على سطحية تفكير الملحدين والمتلقين لهذا الهراء فهي :
وبالله عليك : هل عندما أرى بيتا ًكبيرا ًبارع الجمال والتنظيم والإبداع : ثم آتي إلى باب صغير في وسط باب المدخل الكبير فقال : هذا الباب الصغير ليس له فائدة !!!.. لأن الباب الكبير يفي بالغرض !!!.. ثم أحكم - ولهذا السبب فقط وترك كل الإبداع الآخر - أحكم أن صاحب هذا البيت الكبير لا يفهم شيئا ً!!.. بل وأنه بهذا الخطأ الصغير : أثبت أن البيت ليس له صانع أصلا ًبل هو صدفة !!!.. ولم يدر المسكين أن أهل البيوت الكبيرة مثلا ًيفتحون الباب الكبير فقط : عندما تستدعي الحاجة لذلك مثل دخول حشود ومجموعة كبيرة من الزائرين مثلا ًأو في دخول أثاث ضخم .. وأما غير ذلك : فهم يستخدمون الباب الصغير لدخول الشخص والشخصين فقط : وتوفيرا ًللوقت والجهد !!!!..

فهذا فقط مجرد مثال : لما كان من المفترض بك زميلي وغيرك أن تفكروا فيه أصلا ً!!!..
وإلا بالله عليك - وللمرة الثانية - :
ألم تفكر أصلا ًفي كيف انتقلت الأسماك من البحر إلى البر طالما كانت بذلك الغباء الذي لم تستطع فيه تلافي خطأ مثل هذا الخطأ في زعمكم لعصب واحد ؟؟!!!..
ألم تفكر كيف ظهرت لها أيدي وأرجل وجهاز تنفسي كامل جديد وجهاز إخراجي كامل جديد : وما استلزمه كل ذلك من إعجازات في التوصيل العصبي الملائم لها وحتى أصغر الأصابع أو الحوافر أو الأطراف ؟!!!..
هل تدري شيئا ًزميلي أنت أو غيرك من الملحدين عن مدى تعقيدات الجهاز العصبي في أي حيوان ؟!!!..
فهل بعد كل ذلك الإعجاز : تشكون في أن هذا العصب الجنجري بهذه الصورة :
فيه خطأ ؟!!!..
سبحان الله العظيم ...

3...
وحتى الزرافة التي يتشدق بها المخبول داوكينز : أفلم يسترعه النظر ابتداء ًفي إعجاز تركيب رقبتها التي ادعوا استطالتها صدفة ًوتطورا ًأعمى ؟!!!..
هل استوقفه كيفية وصول الدم من القلب إلى مخ الزرافة ؟!!!..
حيث حباها الله تعالى بقلب كبير : يستطيع ضخ الدم إلى هذا المخ رغم ارتفاعه فوق مستوى القلب بحوالي ثلاثة أمتار !!!..



حيث حتى مع افتراض أن ضغط دم الزرافة من القوة بحيث يتغلب علي الجاذبية الأرضية فيصل إلى المخ : فإن هذا الضغط بهذه الصورة كفيل أيضا ً- نظريا ً- بتفجير الأوعية الدموية الرقيقة في العين والمخ نفسه !!!..
أو حتى دفع الدم إلى الخارج في حالة الاسترخاء أو إنزال الرأس !!!..
وكل ذلك لا يحدث أبدا ً..!! بل تحيا الزرافة حياتها بكل حرية وتلقائية بغير خوف من هذه المسألة إطلاقا ً!!!..

فما هذه الانتقائية الخبيثة في التعرض لتفاصيل مخلوقات الله زميلي ؟!!..
حيث يتركون الإعجاز الذي يشاهده كل البشر : ويذهبون للشبهة التي لا يعرف ردها أكثر العوام ؟!!!..
ألم أقل لك عن خبثهم وعدم أمانتهم ؟!!!..
وإليك هذا الرابط - فوق البيعة - : عن الإعجاز في خلق الإبل التي قال عنها المولى عز وجل :
" أفلا ينظرون إلى الإبل : كيف خـُلقت " ؟!!!..
http://abohobelah.blogspot.com/2012/06/6_9264.html

4...
وأما النقطة الأخيرة - وقبل الدخول مباشرة ًفي نسف شبهتك وشبهة داوكينز - فهي :
هل ترى - وإذا كنت قارئا ًبالفعل لكلام التطوريين عن الانتخاب الطبيعي - : هل ترى فجاجة التناقض عندما ينسبون لذلك الانتخاب تارة : القدرة الرهيبة على حسن اصطفاء الأصلح : وتنحية الغير صالح أو الذي لا فائدة منه : ثم لما يريدون نقد مخلوقات الله تعالى بعد الظهور العلمي لمبدأ (التصميم الذكي) الذي قصم ظهورهم بعيدا ًعن لهجة الدين : هل رأيتهم كيف رجعوا فنسبوا للانتقاء الطبيعي الغباء والعمى وترك الأخطاء : لملايين ومئات الملايين من السنوات بغير تعديل ولا إقصاء ؟!!!..
ألم ترى شبهاتهم عن الريتروفيروس أو الجانك جين : وكيف ترك الانتخاب الطبيعي هذه الأخطاء في الجينات لملايين السنين ؟!!!..
ألم ترى الآن سماجة قولهم بأن خطأ ًمثل الخطأ المزعوم هذا للعصب الحنجري :
ظلت تحمله ((((( كل )))))) الكائنات الحية منذ تطور الأسماك : ومرورا ًبكل الفقاريات : زواحف - برمائيات - ثدييات : زراف وحتى الإنسان !!!..
فسبحان الله العظيم على تلجلج الباطل وتناقضه دوما ً!!!.. وصدق القائل والله :
" الحق أبلج : والباطل لجلج " !!!..

ولا يغرنك زميلي الضجات الإعلامية التي يفتعلها الملاحدة مع كل كذبة :
فبعد قليل منها ينقشع الضباب وتهدأ الموجة وينكشف الماء عن الحقيقة مثل كل مرة !!!..
وها هي التي كانوا يسمونها بـ (الزائدة الدودية) في جسم الإنسان :
أيضا ًظلت فترة ًلم يكونوا يعرفون لها فوائد محددة - ولذلك سموها بالزائدة - !!..
وجعلها الملحدون من أكبر دلائلهم على عدم وجود خالق حكيم :
< وتماما ًكما يتشدقون الآن بهذا العصب الحنجري الراجع وصدقتهم أنت >

فانقصمت ظهورهم باكتشاف فوائدها من إنتاج وحفظ مجموعة متنوعة من البكتيريا والجراثيم : والتي تلعب دوراً مفيداً للمعدة !!!..
http://www.quran-m.com/firas/arabico...&select_page=2

5...
والآن .. مع البهاريز ...
والشكر موصول لأخي الحبيب الإشبيلي من الرابط التالي من منتدى كلمة سواء : فهو الذي فصل وبحث وترجم جزاه الله خيرا ً: ومالي الآن إلا العرض :
http://www.kalemasawaa.com/vb/t18741-2.html

6...
ولشرح الشبهة أولا ًلمَن لا يعرفها : نقول :
أن هناك فرع ٌمن العصب الحائر : يسمى عصب الحنجرة الراجع (بفرعيه اليمين واليسار) Recurrent laryngeal Nerve ويُطلق عليه اختصارا ً RLN : حيث يظن التطوريون - أو هكذا أرادوا إيهام مَن يسمع لهم - : أنه لا وظيفة له من المخ : إلا فقط : الوصول للحنجرة !!!.. وعلى هذا :
فقد اصطنعوا التعجب من كيف أنه ينزل هذا العصب ليلتف أولا ًحول الشريان الأبهر في الصدر عند القلب : ثم يرجع للحنجرة !!!..
وذلك في كل الحيوانات !!.. وعلى الأخص الزرافة لطول المسافة بين المخ والقلب والتي قد تصل لـ 3 متر : يقضيها هذا العصب في الذهاب والإياب بدون أية فائدة تذكر - حسب قولهم المكذوب - في حين كان ممكن أن يتصل مباشرة بالحنجرة في أعلى الرقبة وانتهى !!!..
ومن ذلك خرجوا بقولهم أن هذا من أقوى الأدلة على : سوء تصميم ..!



لأنه طالما كان الهدف (الوحيد) لهذا العصب هو فقط الوصول للحنجرة :
فكان الواجب - لو كان هناك خالق حكيم أو تصميم ذكي - : أن ينزل من المخ إلى الحنجرة في أعلى الرقبة مباشرة : دون الحاجة للوصول إلى الصدر أولا ًثم الرجوع إلى الحنجرة !!!..

ومن أشهر مَن نفخ وركز على هذه الكذبة والشبهة المتهافتة مثله :
ريتشارد دوكينز (أو دونكي كما يسميه العقلاء) .. كوين جيري .. شوبين نيل .. مات ريدلي وغيرهم ..
فما هو الرد إذا ً؟؟!!!..

1))
أنه يوجد بالفعل عصب يصل من المخ إلى الحنجرة مباشرة ً!!!!.. وهو غير هذا العصب الحنجري صاحب الشبهة !!!.. وبذلك ينهدم جزء كبير من استدلال وتعجب هذا الدونكي ريتشارد !!!.. ألا وهو العصب الحنجري العلوي Superior Laryngeal Nerve والذي يُطلق عليه اختصارا ً: SLN
وبذلك يتحقق طلب الدونكي ريتشارد في مقطع الفيديو إذا كان هناك مصمم ذكي !!!..
ويُعرف بذلك أيضا ًأنه يكون لهذا العصب يقينا ًفوائد أخرى غير العصب الأول العلوي !!
وإليكم الصورة التالية : ترون فيها العصب الحنجري العلوي : هو الأول من أعلى : والآخر الراجع : هو الأخير من أسفل :



< ملحوظة لمَن يعلم : مع كل تفنيد لشبهة لهذا الحمار : يتبين أنه لا يعرف شيئا ًعن علم التشريح ! >

2))
أن هذا الدونكي ريتشارد : استخدم الكذب حيث ادعى فقط وأوهم مَن يستمعون له ويصدقونه : أن هذا العصب الحنجري : مجرد ينزل فقط إلى منطقة القلب في الصدر ثم يصعد إلى الحنجرة !!!.. وبدون أن يذكر أولا ًأنه فرع من العصب الحائر (أو المبهم وهو النازل أصلا ًمن المخ إلى أسفل) : ومن غير أن يذكر ثانيا ًوظيفة هذا العصب الراجع في تغذيته للقلب والمرئ والقصبة الهوائية قبل أن يصل إلى الحنجرة ..!!
وإليكم النقل التالي من الويكيبديا عن عصب الحنجرة الراجع :
http://ar.wikipedia.org/wiki/%D8%B9%...A7%D8%AC%D8%B9



حيث سنعد معا ًالوصلات التي يصلها هذا العصب في الجسم : ومن الرابط أعلاه :

" يشار إليه بأنه "راجع" لأن فروعه تعصّب عضلات الحنجرة في الرقبة خلال طريق ملتوية إلى حد ما؛ فهي تنحدر نحو القفص الصدري قبل أن ترتفع ما بين القصبة الهوائية والمريء لتصل إلى الرقبة.
العصب الحنجري اليسار -والذي هو الأطول- يتفرع من العصب المبهم ويلتف تحت قوس الشريان الأبهر، خلف الرباط الشرياني ثم يصعد. من الناحية الأخرى يلتف الفرع الأيمن حول الشريان تحت الترقوة اليمنى. مع التفاف العصب الراجع حول الشريان تحت الترقوة أو الشريان الأبهر يعطي عدة خيوط قلبية للجزء العميق من الضفيرة القلبية. وأثناء صعوده في الرقبة يعطي فروعًا (تكون أكثر في الجهة اليسرى) إلى الغشاء المخاطي والحائط العضلي في المريء، ويتفرع إلى الغشاء المخاطي والألياف العضلية في القصبة الهوائية، ويعطي بعض الخيوط البلعومية إلى العضلة البلعومية المضيّقة العلوية.
ينقسم العصب إلى فرعين أمامي وخلفي ثم يزود العضلات في الحنجرة، فهو يزود كل عضلات الحنجرة باستثناء العضلة الحلقية الدرقية التي يعصّبها فرع خارجي من العصب الحنجري العلوي.
يدخل العصب الحنجري الراجع في البلعوم جنبًا إلى جنب مع الشريان الحنجري السفلي والوريد الحنجري السفلي، تحت العضلة المضيّقة السفلية ليعصّب عضلات الحنجرة الداخلية المسؤولة عن التحكم في تحركات الطيات الصوتية
" ..!

وبالطبع له أهمية كبيرة في أثناء العمليات الجراحية في الرقبة وخصوصا ًعمليات الغدة الدرقية ..
أقول :
ولا يخفى ما لاتصاله بالقلب من أهمية في التحكم في عمليات القلب الدقيقة للأجهزة التي يتصل بها هذا العصب كما رأينا :
ولا تخدعنا الإضافة الآلية اليتيمة التي أضافها التطوريون في الصفحة - كعادتهم في الويكيبديا - بأن ذلك العصب وبصورته هذه : له علاقة بالتطور !
ثم حكوا نفس الاسطوانة المشروخة من أساطير التطور من عهد الأسماك !!!..
< بالمناسبة : لهم قصص لتفسير طول أنف الفيل وقصص لكيفية ظهور اللبن وغيرها : تقلب الإنسان على قفاه من الضحك ما شاء الله : مبدعين ! >

3))
قام العالم الأحيائي Wolf-Ekkehard Lِnnig من معهد بلانك لتربية النبات : بنشر بحث بعنوان : The Laryngeal Nerve of the Giraffe: Does it Prove Evolution?
http://www.weloennig.de/LaryngealNerve.pdf

وقال فيه أن من 0.3 إلى 1 بالمئة من البشر : لديهم (( عيب )) في عصب الحنجرة الأيمن لديهم : حيث أنه قصير !!!.. ويسلك بالفعل طريقا ًمختصرا ًإلى الحنجرة !!!.. وقال أن ذلك (( عيب خلقي )) يعرف بـ : عصب الحنجرة اللادوراني Non-Recurrent' Laryngeal Nerve
وفي هذه الحالة : فقط الجزء الأيمن من العصب هو الذي يتأثر غالبا ً: ويصاحب ذلك تضخم في الشريان تحت الترقوة اليمنى من قوس الأبهر في جانبه الأيسر

وإليكم النص بالإنجليزية :
The fact is that even in humans in 0.3 to 1% of the population the right recurrent laryngeal nerve is indeed shortened and the route abbreviated in connection with a retromorphosis of the forth aortic arch. ("An unusual anomaly ... is the so-called 'non-recurrent' laryngeal nerve. In this condition, which has a frequency of between 0.3 - 1%, only the right side is affected and it is always associated with an abnormal growth of the right subclavian artery from the aortic arch on the left side"
Gray's Anatomy 2005, p. 644.; see also Uludag et al. 2009

والسؤال الغريب هنا - ولكل مَن يؤمن بقدرة وفاعلية إلهه وخالقه الانتخاب الطبيعي الجبارة :)): -
إذا كانت الطفرات مثل تلك التي تجعل العصب أقصر : ما زالت تحدث حتى الآن على الصعيد البشري !!.. فهذا يعنى أنها حدثت لملايين لهم من قبل بل ولغيرهم من الثديات وباقي الفقاريات الأخرى :
فلماذا - وووفقا ًللانتخاب الطبيعي - : لم يتم انتخاب وانتقاء هذه الحالات : ويتم إقصاء الحالات الأخرى التي فيها العصب أطول طريقا ًبغير فائدة بزعمهم ؟!!!..

وفي الحقيقة : أن العكس هو الموجود (لأن قصر هذا العصب هو الذي يعد عيبا ً!!) !!..
يقول العالم الأحيائي Wolf-Ekkehard في ذلك :

All these 'short-cut mutations' were regularly counter-selected due to at least some disadvantageous and unfavourable effects on the phenotype of the so affected individuals

والترجمة :
" كل هذه الطفرات (أي التي تجعل مسار العصب قصيرا) : تم اقصاؤها على الأقل : بسبب غير ملائمتها والآثار غير المؤاتية على النمط الظاهري للأفراد المتضررين " ..!

4))
وفي نفس السياق السابق : ومن الرابط التالي :
http://casereports.bmj.com/content/2...2008.1107.full

وتحت الموضوع التالي :
Anatomic variations of the non-recurrent inferior laryngeal nerve

نقرأ :
DESCRIPTION

The non-recurrent inferior laryngeal nerve (NIRLN) is a rare anomaly (0.5–0.6% on the right side, extremely rare on the left side (0.004%)), which increases the risk of damage to the nerve during surgery. The right NRILN is associated with a right subclavian artery arising directly from the aortic arch. The left NRILN is associated with situs inversus.1–3


والترجمة :
" العصب الحنجري الغير ملتف (اللادوراني) هي حالة نادرة بنسبة 0.5 الى 0.6 % في الجهة اليمنى .. وتعتبر نادرة جدا بنسبة 0.004% في الجهة اليسرى .. والتي قد تزيد من الخطورة في اتلاف هذا العصب أثناء الجراحة .. وفي هذه الحالة فقط : الجزء الأيمن هو الذي يتأثر ويصاحب ذلك تضخم في الشريان تحت الترقوة اليمنى من قوس الأبهر في جانبه الأيسر " ..!!

وهو تكرار لنفس ما قرأناه في النقطة السابقة : والذي يؤكد على أن العصب بالصورة التي أرادها الدونكي ريتشارد : يُعد عيبا ًوخللا ًيستدعي علاجه !!!..
فسبحان العليم الحكيم !!!..

5))
وأما الأعجب والأعجب ..
فهو أنه تم اكتشاف فائدة من اتصال ولف هذا العصب الحنجري بالشريان الأبهر عند القلب : وذلك في مرحلة التكون الجنيني السادسة عشر !!!..
وهي فائدة غريبة وفريدة جدا ًلا تدل إلا على الخالق سبحانه ولا دخل لخرافة الصدفة ولا خبل التطور والعشوائية بها !

فالعصب الحنجرى الراجع الأيسر : يلعب دوراً محوريا فى تكوين القناة الشريانية : ductus arteriosus وهى عبارة عن شريان عضلى muscular artery : فريد من نوعه ووظيفته في تلك الفترة الهامة من تكون جنين الإنسان تحديدا ً!!.. حيث يصل بين الشريان الرئوى والأورطى فى الجنين : أثناء وجوده فى الرحم ...
وهو المسؤل عن انحراف الدم المؤكسج الآتي من الحبل السرى بعد أكسجته فى المشيمة : فيأخذه بعيدا ًعن الرئة : ليدخل إلى الأورطى مباشرة ..!!
وذلك لأن الأجنة لا تتنفس عن طريق الرئة .. بل عن طريق المشيمة من خلال الأكسجين المار بدم الأم ...!
فبالله عليكم :
هل مثل هذه التفاصيل الدقيقة : هل هي عرضة أصلا ًللتطور الأعمى وتجربة الصواب والخطأ لتختار الصدفة والانتخاب المزعوم من بينها ؟!!..
أم أنها خلقت مرة واحدة مثلها مثل آلاف العلاقات في أجسام الكائنات الحية التي لا يتصورها عاقل ولا بأي منطق : إلا أنها خلقت هكذا مباشرة ً!!!..
ونواصل ...

هذه القناة العضلية : لها مواصفات خاصة لا تشبه أيا من شرايين الجسم !!.. فهى تعتبر شريان عضلى غير مطاط : يسمح بمرور كمية ضخمة من الدم بين شريانين : هما الأكبر فى جسم الإنسان ..!! وأما السبب فى ذلك : فهو العصب الخاص بموضوعنا هنا وهو الحنجري الراجع Ltrecurrent laryngeal nerve ...!
حيث يقوم هذا العصب - وبالتفافاته التي لم تعجب الحمار داوكينز - : يقوم بالشد على تلك القناة خلال التفافه حولها .. ويؤهله لذلك طبيعته الخاصة من محتواه من الأنسجة الليفية fibrous tissues أكثر من باقي الأعصاب الأخرى .. وهو ما يمكنه من لعب هذا الدور الفريد وحده فى تكوين الجهاز الدورى فى الأجنة ..
والترجمة السابقة هي لأخي الحبيب الدكتور حسن المرسي .. وذكر ذلك من كتاب التشريح الشهير :
grays anatomy الطبعة 39 صفحة 30 ...

وإليكم النص باللغة الإنجليزية :

However, just to refer to one possible substantial function of the Nervus laryngeus recurrens sinister during embryogenesis: "The vagus nerve in the stage 16 embryo is very large in relation to the aortic arch system. The recurrent laryngeal nerve has a greater proportion of connective tissue than other nerves, making it more resistant to stretch. It has been suggested that tension applied by the left recurrent laryngeal nerve as it wraps around the ductus arteriosus could provide a means of support that would permit the ductus to develop as a muscular artery, rather than an elastic artery"
Gray's Anatomy, 39th edition 2005, p. 30

6))
وأخيرا ً...
فتجدر الإشارة إلى أن هناك أهمية كبيرة أيضا ًلكون العصب المرتد الحنجرى يصعد للحنجرة من الأسفل ..
وهى أنه بهذه الطريقة : يوفر تغذية عصبية ثنائية للحنجرة ..! بحيث لو انقطع أحد العصبين السفلي الراجع أو العلوى : تظل الوظيفة محفوظة يالآخر ..!!
ولا يتسبب هذا الإنقطاع بفشل كامل للحنجرة ...!!!

وسبحان الله رب العالمين !!!..

__________________


<< حضور متقطع >>
حوار مع مسلم - اضغط هنا
ما يجب أن تعرفه عن نظرية التطور - اضغط هنا
هدم أسس الإلحاد - اضغط هنا
مدونتي - اضغط هنا
فرق ومذاهب وأحزاب وأديان معاصرة - اضغط هنا
إلى كل نصراني - اضغط هنا
فضح جهالات المدعو عمر المناصير - اضغط هنا
حقيقة المجوس الشيعة الروافض - اضغط هنا
عقد الضفيرة على شانئي أبي هريرة - اضغط هنا
الثورة المصرية .. وعقول ٌسلفية - اضغط هنا
رد مع اقتباس
  #112  
قديم 2012-09-04, 09:39 AM
أبو حب الله أبو حب الله غير متواجد حالياً
محـــاور
 
تاريخ التسجيل: 2011-10-24
المشاركات: 305
افتراضي


متفرقات ...
شبهة تطور إحدى سحالي أوروبا (سحلية الحائط الإيطالية) !!..

وقد حاورني فيها أحد الأخوة منذ أيام قائلا ً:

اقتباس:
بعد مشاهدة فيديو على اليوتوب يقول ان التطور تم مشاهدته بالفعل حيث تم نقل سحالي من دولة لأخرى فاصبحت خلال ثلالثين عام من آكلي حشرات الى آكلي نباتات. لا استطيع ايجاد الفيديو مرة اخرى ارجو المعذرة. الفيديو ليس فيه تفاصيل بل ذكر فقط الحيوان فبحثت عنه في ويكيبيديا:
http://en.wikipedia.org/wiki/Italian_wall_lizard


فأنقل ردي عليه هنا للفائدة .. والله المستعان ..
---------

أخي الكريم ...
لقد اطلعت على الرابط من الويكيبديا ..
ووجدتها عملية كذب ونصب وغش ( عادية جدا ً) من التي احترفها التطوريون ..
حيث اعتادوا على تزييف الحقائق وتلبيسها بظواهر وكائنات عادية ولكنهم يغشون في التعليق عليها والنتائج والافتراضات ..
وهو ما يذكرني بخدعتهم من قبل عن فراشات التطور ..! ويمكنك متابعة الفضيحة من الرابط التالي :
http://abohobelah.blogspot.com/2012/06/4.html

وأما في شبهتهم هذه المرة :
فقد جاءوا إلى نوعين مختلفين من السحالي - وبالاختلافات الجسمية والسلوكية التي ذكروها هم أنفسهم - : ثم كذبوا فقالوا بأن أحد النوعين : قد تطور من الآخر !!..
بس ....
هيا دي كل الحكاية أخي ...
وإليك التفاصيل في نقاط ...

1...
قد لا يعرف الكثيرون أن هناك أنواع من السحالي بالفعل تأكل النباتات ...!!
فإن الطعام الأساسي للسحالي هو الأشياء اللينة .. وذلك لأن أغلب السحالي لها أسنان قصيرة تمسك بها الطعام ولكنها لا تقطعه .. وعلى هذا فطعامها الأساسي الحشرات والأشياء الطرية .. ومنها ما يأكل النباتات والفواكه أيضا ً!!!..
رأيت أن أذكر ذلك لأن البعض ممَن ليس لديه أية خلفية عما يسمع أو يقرأ : قد يظن أن السحلية موضوع الشبهة للتطوريين : قد تطورت من أكل الحشرات إلى أكل النباتات !!..
وإليك الدليل على أن من السحالي أصلا ًما يأكل النباتات والفواكه ..
ففي رابط الموسوعة التالي عن السحالي نقرأ :
http://www.almaoso3a.com/3743/39/11/...%84%D9%8A.html

تتغذى السحالي على الحشرات التي تمسكها بلسانها , وتأكل الطعام الطري ولها أسنان تساعدها على الإمساك بالطعام دون تقطيعه إذ تبتلعه كاملاً . وبعض السحالي لها نظام غذائي خاص .
فالسحلية ذات القرن تأكل النمل , والسحالي الأخرى تأكل النباتات أحياناً والفواكه . أما سحلية الموينتور فهي السحلية الوحيدة التي تأكل اللحوم والحيوانات الميتة وأحياناً تمسك بالخنازير الصغيرة وتبتلعها كاملة .


وأما من رابط الويكيبديا التالي عن السحالي :
http://en.wikipedia.org/wiki/Lizard

ومن منتصف الصفحة تقريبا ًتحت عنوان (Relationship with humans) أو علاقتها مع الإنسان .. وبجوار صورة سحليتي تنين الكومودو نقرأ :

Lizards are predominantly insectivorous, but some eat fruit, or vegetables. Live crickets and worms are the most typical foods for pet lizards

والترجمة :
أغلب السحالي هي من آكلات الحشرات .. ولكن بعضها تأكل الفاكهة أو الخضروات .. وتعد الصراصير الحية والديدان هي الأطعمةب الأكثر شيوعا ًللسحالي الأليفة ..

والآن .. نأتي للقصة المذكورة في الرابط الذي ذكرته أنت من الويكيبديا أخي ...

2...
فالقصة باختصار :
هي أن السحلية P. sicula (سحلية الحائط الإيطالية) : تم في عام 1972 نقل عشرة بالغين منها : من جزيرة Pod Kopište إلى جزيرة Pod Mrčaru التي تبعد عنها فقط 3.5 كلم شرقا ًبكرواتيا ..
ثم مع انتهاء الحروب اليوغوسلافية (يقصدون البوسنة والهرسك إلخ) : عاد العلماء إلى الجزيرة الثانية : فماذا وجدوا ؟؟؟..
< هكذا بقدرة قادر : وفي 35 سنة مش ملايين السنين يا بلاش : من 1972 : 2007 تقريبا ً> :
وجدوا نوعا ًمتغيرا ًكثيرا ًمن السحالي !!!..
حيث يعتمد في أكله على النباتات وليس الحشرات : وعلى هذا صاحبته عدة تغيرات في جسده سواء من الداخل لتوائم هضم النباتات : أو من الخارج !!!...
شوف يا أخي إزاي !!!..

فقوة العضة أقوى !!.. ومتوسط الحجم أكبر !!!.. < كل ده ولسه شايفين ومصرين إنها نفس النوع من السحلية !! > وأطراف خلفية أقصر !!!.. ومتوسط سرعة عدو أو جري أبطأ !!!.. وتغير في الاستجابة لمهاجمة السكان !!!.. ووجود اختلاف في المصران الأعور لتبطيء مرور الطعام وتوفير غرف تخمير لكي تستطيع الميكروبات تحويل السيليلوز لهضم الطعام النباتي !!!.. وكذلك وجود ديدان خيطية في تلك السحالي ليست موجودة لدى سحالي الجزيرة الأولى !!!..

بس ...
انتهت الخدعة ... أقصد القصة ....!
وإذا لم تكن قد وقفت بعد على أبعادها أخي الكريم : فإليك بعض المفاتيح :

1))
يقولون أنه لما وجد العلماء تلك الاختلافات الكبيرة : قاموا بعمل تحليل حمض نووي DNA لنوع السحلية في الجزيرة الأولى : والذي وجدوه في الجزيرة الثانية : فماذا وجدوا ؟؟..
وجدوا أنه شبيه به !!!.. فقط ..
مثلما يتشابه أي نوعان من فصيلة واحدة من الكلاب والذئاب إلخ !!!..
وإليك النص بالإنجليزية :
While mitochondrial DNA analyses have verified that P. sicula currently on Pod Mrčaru are genetically very similar to the Pod Kopište source population

2))
هذا التطور المزعوم : لا دليل عليه .. لأنه لم يشاهده أحد أصلا ًولم يتابعه أحد بالتدوين والملاحظة كأي فريق علمي محترم - ولا سيما مع ظاهرة جديرة بالاهتمام مثل هذه لو صحت لقلبت الكفة إليهم ولكنهم يعرفون أنهم مخادعين !! - إلخ .. وعلى هذا فافتراض التطور المزعوم ليس عليه شهود وذلك باعترافهم أنفسهم :
and the P. sicula expanded for decades without human interference,

بمعنى :
أن الأمر لا يعدو كونه مجرد (افتراض عمياني) ...!
وأن السحالي في الجزيرة الثانية : هي نوع آخر أصلا ًوليست هي نفسها التي في الجزيرة الأولى !!!..

3))
وأما الأغرب والأغرب لبطلان هذه الفرضية الخيالية التي لا دليل عليها :
فهو أن صفات الجزيرتين أصلا ً: تكاد تكون متطابقة !!!!..
فما الذي أدى لتغير هذه السحالي في الجزيرة الثانية : وعدم تطور الأخرى التي في الجزيرة الأولى !!!!..
فالجزيرتان : في نفس الموقع من البحر الأدرياتيكي وكما قالوا هم بأنفسهم : ولا يفصلهما إلا 3.5 كم فقط !!!..
In 1971, ten adult P. sicula specimens from the island of Pod Kopište were transported 3.5 km east to the island of Pod Mrčaru (both Croatian islands lie in the Adriatic Sea near Lastovo)

وأما الأكثر غرابة : فهو أن الجزيرتين لهما نفس :
الحجم !!!.. والارتفاع !!!.. والمناخ المحلي !!!.. والغياب العام من الحيوانات المفترسة الأرضية !!!!...
The two islands have similar size, elevation, microclimate, and a general absence of terrestrial predators

فهل اتضحت الصورة الآن أخي الكريم ؟!!!..

ولا يغررك كتابتهم لافتراضاتهم الخيالية في كتب أو مجلات أو في النت إلخ !
ولذلك وضعت لك موضوع الفراشات المزورة وتزويرهم للحقائق + غشهم في التصوير إلخ !
فهذا ديدنهم إن كنت قرأت موضوع التطور هنا : أو من مدونتي إذا كنت لا تعرفهم :
http://abohobelah.blogspot.com/2012/...g-post_28.html

وأما إذا صادفت ملحدا ًعنيدا ًممسوح العقل لا يريد أن يقتنع :
فقل له :
ائتني بشهادة موثقة من أهل الجزيرة الثانية : أن هذا النوع من السحالي لم يكن موجودا ًلديهم من قبل !!!..

وأخيرا ً- وهي قاصمة الظهر لأمثالهم - :
أن التطور بصورته هذه التي أعلنوا عنها : هو من أتفه الافتراضات التطورية : لأنه يفترض تحور الكائن تبعا ًوملاءمة ًلظروف بيئته الخارجية !!!..
ومع استحالة تطور كائن بظهور عضو جديد (صدفة) حتى ولو كان تطور في أعضائه الداخلية :
إلا أن المسألة أصلا ًساقطة علميا ًلأنه بفرض حدوثها (جدلا ًفقط) في سحلية واحدة أو حتى العشرة مرة واحدة : فيستحيل تناقل وتوريث هذه الصفات الجديدة المكتسبة في حياتهم : إلى أبنائهم وأحفادهم !!.. أو انتقاله من أجسادهم نفسها : ليكتسب جينات وشيفرات وراثية على الحمض النووي !!.. وذلك تبعا ًللقاعدة والقانون الوراثي الشهير القاصم للتطور :

((( الصفات المكتسبة : لا تورث ))) !!!!..

والله الموفق ...

__________________


<< حضور متقطع >>
حوار مع مسلم - اضغط هنا
ما يجب أن تعرفه عن نظرية التطور - اضغط هنا
هدم أسس الإلحاد - اضغط هنا
مدونتي - اضغط هنا
فرق ومذاهب وأحزاب وأديان معاصرة - اضغط هنا
إلى كل نصراني - اضغط هنا
فضح جهالات المدعو عمر المناصير - اضغط هنا
حقيقة المجوس الشيعة الروافض - اضغط هنا
عقد الضفيرة على شانئي أبي هريرة - اضغط هنا
الثورة المصرية .. وعقول ٌسلفية - اضغط هنا
رد مع اقتباس
  #113  
قديم 2012-09-18, 10:42 PM
ام حسن ام حسن غير متواجد حالياً
عضو جديد بمنتدى أنصار السنة
 
تاريخ التسجيل: 2012-09-18
المشاركات: 9
افتراضي

السلام عليكم ورحمة الله وبركاته
جزاك الله خيرا على المجهود العظيم
واود ان اعرف اكثر عن الحفرية ايدا التي يقال انها من 47 مليون سنة
واشكرك مرة اخرى
رد مع اقتباس
  #114  
قديم 2012-09-22, 01:29 AM
أبو حب الله أبو حب الله غير متواجد حالياً
محـــاور
 
تاريخ التسجيل: 2011-10-24
المشاركات: 305
افتراضي

[align=center]
أعتذر عن تأخر رؤيتي لمشاركتك أختي الفاضلة للانشغال ...
وسوف أجيبك في أسرع فرصة بإذن الله تعالى ....
[/align]
__________________


<< حضور متقطع >>
حوار مع مسلم - اضغط هنا
ما يجب أن تعرفه عن نظرية التطور - اضغط هنا
هدم أسس الإلحاد - اضغط هنا
مدونتي - اضغط هنا
فرق ومذاهب وأحزاب وأديان معاصرة - اضغط هنا
إلى كل نصراني - اضغط هنا
فضح جهالات المدعو عمر المناصير - اضغط هنا
حقيقة المجوس الشيعة الروافض - اضغط هنا
عقد الضفيرة على شانئي أبي هريرة - اضغط هنا
الثورة المصرية .. وعقول ٌسلفية - اضغط هنا
رد مع اقتباس
  #115  
قديم 2012-09-26, 12:01 PM
أبو حب الله أبو حب الله غير متواجد حالياً
محـــاور
 
تاريخ التسجيل: 2011-10-24
المشاركات: 305
افتراضي

متفرقات ...
آدم وحواء والتنوع الجيني ...

الأخوة الكرام ..
منذ فترة كنت أجبت على تساؤلات لأخت في منتدى التوحيد عن آدم وحواء والتنوع الجيني ..
حيث قالت :
-----

السلام عليكم ورحمة الله وبركاته
بسم الله الرحمن الرحيم

أخواني وأخواتي فى منتدى التوحيد بارك الله فيكم جميعا .......
موضوعي اليوم شوية محتاج جمع بين العلم والدين ....
وتساؤلى اليوم عن التنوع الجيني فى البشر هل هو أساسه كله فقط من أدم عليه السلام وحوا ......... أم أن الله سبحانه وتعالى خلق خلق آخر بعد آدم عليه السلام
وهل الله سبحانه وتعالى أوضح فى القرأن الكريم فيما معناه انه لم يخلق في البشر غير آدم عليه السلام فقط كأساس لذرية بني أدم وهناك تأكيد على ذلك ؟!!! أى ( اتى باقى الخلق من صلبه؟!!! وما الدليل ؟ ).........

أرجو التوضيح بالتفسير وبالقرآن الكريم
وما معنى تلك الآية الكريمة (إن يشأ يذهبكم ويستخلف من بعدكم ما يشاء كما أنشأكم من ذرية قوم آخرين ) ‫الانعام 133
والأية ( إن يشأ يذهبكم ويأت بخلق جديد )
--------


فقمت بتقسيم إجابتي عليها إلى أكثر من جزء ..
بين :
أمثلة وراثية علمية على عدم تعارض التنوع الجيني من آدم وحواء ..
وبين :
مثال عملي من حياتنا الواقعية بخصوص مزج الألوان في الطابعات ..
وبين :
نقل تفاسير الآيات التي ذكرتها الأخت ..
فأنقلها هنا للإفادة مع بعض التصرف اليسير والله الموفق ...
-----------
-----------------------

أهلا ًبك أختنا الفاضلة ...

قبل بيان تفاسير العلماء للآيات أختي الكريمة :
أود أولا ًاستعراض إجابة كنت أجبت بها أحد الإخوة على سؤاله التالي المنقول عن أحد التطوريين :

سؤالي لك اذا كان التطور غير صحيح فكيف تفسر وجود ثمان فصائل للدم a- a+ b- b+ o- o+ ab- ab+ , كيف وجدت هذه الفصائل من رجل وامرأه فقط ؟

فأجبته بالآتي :
-------------

وأما بالنسبة لفصائل الدم وأنواعها الثمانية ...

فسوف أ ُجيب هنا بكل بساطة واختصار : إلا لو أراد المعاند الاستفاضة ..
أقول ...

1...
أول خطأ بالنسبة للشبهات الوراثية التي يثيرها التطوريون والملحدون عن آدم وحواء : هو افتراض أن حواء كانت مماثلة لآدم في كل شيء (أي في الجينات أيضا ً) أقول :
كيف هذا بالله عليكم : وأبسط شيء يتبادر لعقل العاقل هو أنها كانت (امرأة) كاملة النضج والأنوثة وهو (رجل) ؟!!!!..
فهل هذا على الله ببعيد ؟؟.. أن يُخرج حواء من آدم بجينات مختلفة عنه ؟!!..
أوليس لنا في ولادة المسيح من أمه مريم عليهما السلام : خير مثال ؟!!..
حيث أنه من المعلوم التوالد العذري أو البكري لو وقع في الكائنات الحية (وهو أن تلد الأنثى بمفردها بغير ذكر حيث تبدأ بويضتها في التضاعف بمفردها) : أولم تعلموا أنها كان من المفترض ((علميا ً)) ألا تلد إلا أنثى لأنها تحمل كروموسومي الأنوثة فقط XX ؟!!..
فمن أين جاء المسيح عليه السلام بالكروموسوم الذكري Y ؟!!..
إذا ً:
إن خلق حواء من آدم عليه السلام : هو خلق معجز وبجينات جديدة : مثل خلق عيسى من مريم عليهما السلام بجينات مختلفة ..

والشاهد من ذلك بالنسبة لآدم وحواء :
هو أن لكل منهما خريطته الوراثية المخلوقة كرجل وامرأة : والتي تم توزيع الألايل والجينات الوراثية بينهما بحكمة الله عز وجل : لتعطي التنوع الذي نراه في البشرية اليوم !!!..
والكلام لمَن لا يفهم :
أن الله تعالى جعل جيناتهما : تكمل بعضها البعض لإعطاء كافة الاحتمالات التي نراها اليوم في البشر ...

2...
مثال ...
بالنسبة لتنوع وتدرج ألوان البشرة في الإنسان ...
فقد وُجد أن المتحكم في هذه الصفة : ثلاثة أزواج من الجينات على الأقل وقد رُمز لها بـ :
(A) ومقابله (a) - و(B) ومقابله (b) - و(C) ومقابله (c) ..

حيث البشرة الشديدة السواد هي : AA BB CC
والبشرة الشديدة البياض هي : aa bb cc
وأما البشرة المتوسطة اللون بينهما فهي : Aa Bb Cc

وعليه .. فلو افترضنا أن آدم وحواء عليهما السلام كانا ذوي بشرة متوسطة اللون ..
فإنه عند تزاوجهما :
فلدينا 64 احتمالا ًللناتج !!!.. يُمثلون 7 درجات ألوان رئيسية !!!..
(ويماثل حالة آدم وحواء في الصورة التالية : الجيل الأول) :



3...
فإذا فهمنا تلك الحكمة المقصودة في توزيع الله تعالى للجينات بين آدم وحواء بما يخلق التنوع في البشر ..
فإذا طبقناه على شبهة الزميل التطوري عن فصائل الدم أقول ..

ترجع فصائل الدم إلى ثلاثة جينات بديلة وهي : A - B - O
وكل ٌمن A - B سائدين على O ..
وبديلة تعني : أن الإنسان الواحد لا يمكن أن يجمع أكثر من اثنين منها في وقت واحد ..

وعليه .. فلو حمل آدم أو حواء عليهما السلام جينات : AO (أي A)
وحمل الآخر : BO (أي B) لأن A و B سائدين على الـ O كما قلنا :
فإن احتمالات الأبناء ستنتج لنا فصائل الدم الأربعة التالية في أول جيل أبناء :
AB - AO - BO- OO

ولكن لا نزال نفتقد الفصيلة A الخالصة (أي AA) وكذلك الفصيلة B الخالصة (أي BB) : وهذه تأتي في الجيل الثاني من تزاوج AB مع كل ٍمن AO (حيث ينتج لنا في الأبناء AA) ومع BO (حيث ينتج لنا في الأبناء BB) !!!..

وبهذا يكون لدينا كل فصائل الدم المعروفة !!!!...

4...
وأما الموجب والسالب لكل فصيلة :
فيقصد بهما الزميل : عامل ريسيس !!!.. حيث لو كان موجودا ًفي فصيلة : تكون موجبة .. ولو لم يوجد : تكون سالبة !!!..
وأما المفاجأة :
فهي أن عامل ريسيس صفة سائدة .. ويتحكم في ظهورها ثلاثة أزواج من الجينات السائدة وهي المرموز لها بـ (CC- DD - EE) .. ولهذه الجينات ثلاثة بدائل في المقابل متنجية وهي (cc- dd- ee) !!!..
ويمكن مع تطبيق نفس احتمالات لون البشرة كما شرحت في النقطة 2 :
نحصل على الموجب والسالب ...

ولمزيد من المعلومات الوراثية الصفحة التالية :
http://bafree.net/arabneuropsych/bio3.htm

والجزء الخاص بفصائل الدم ويليها عامل ريسيس من منتصف الصفحة بالضبط ..
والحمد لله رب العالمين ..

يُـتبع إن شاء الله بنقل تفسير الآيات ...
------------
---------------------------

والآن أختي الفاضلة ...
لم يأت في القرآن أو السنة ما يُشير تصريحا ًإلى وجود بشر قبل آدم عليه السلام :
أو كونه تطور منهم أو عنهم ..
وحتى كلمة أطوارا ًالمذكورة في آية سورة نوح عليه السلام :
" ما لكم لا ترجون لله وقارا ً: وقد خلقكم أطوارا ً" :

فالأطوار هنا هي المراحل التي يمر بها خلق الإنسان .. سواء خلق آدم من تراب وطين (وكذلك كلنا لأننا منه في الأصل) : أو سواء ما مررنا به نحن من مراحل في التخليق من نطفة إلى علقة إلى مضغة إلخ ..
ويُرجى النظر في الرابط التالي لمزيد من التفصيل :
http://abohobelah.blogspot.com/2012/08/6_11.html

وأما الالتباس الحادث في كلمات ٍمثل (خلق) و (قوم) في القرآن وتفسيره :
فيُزيله كلام العلماء أنفسهم .. حيث يجب معرفة قصدهم بذلك : وقبل تأويله بما يناسب التطور :
فالقرآن حمال أوجه : لمَن قصر به علمه ..
ولعل أبلغ تفسير في بيان تلك الآيات هو تفسير ابن كثير رحمه الله ...
ولكني سأجعله في النهاية ..

وأما تفسير الآية الأولى :
" إن يشأ يذهبكم ويستخلف من بعدكم ما يشاء كما أنشأكم من ذرية قوم آخرين " ..
الأنعام 133 ..

1...
فمن تفسير الطبري :


وأما قوله: { إنْ يَشأْ يُذْهِبْكُمْ وَيَسْتَخْلِفْ مِنْ بَعْدِكُمْ ما يَشاءُ } فإنه يقول: إن يشأ ربك يا محمد الذي خلق خلقه لغير حاجة منه إليهم وإلى طاعتهم إياه { يُذْهِبْكُمْ } يقول: يهلك خلقه هؤلاء الذين خلقهم من ولد آدم { وَيْسَتخْلِفْ مِنْ بَعْدِكُمْ ما يَشَاءُ } يقول: ويأت بخلق غيركم، وأمم سواكم يخلفونكم في الأرض من بعدكم، يعني: من بعد فنائكم وهلاككم. { كمَا أنْشَأكُمْ مِنْ ذُرِّيَّةِ قَوْمٍ آخَرِينَ } كما أحدثكم وابتدعكم من بعد خلقٍ آخرين كانوا قبلكم. ومعنى «مِنْ» في هذا الموضع: التعقيب، كما يقال في الكلام أعطيتك من دينارك ثوباً، بمعنى: مكان الدينار ثوباً، لا أن الثوب من الدينار بعض، كذلك الذين خوطبوا بقوله: { كمَا أنْشأَكُمْ } لم يرد بإخبارهم هذا الخبر أنهم أنشئوا من أصلاب قوم آخرين، ولكن معنى ذلك ما ذكرنا من أنهم أنشئوا مكان خَلْقٍ خَلْفَ قوم آخرين قد هلكوا قبلهم. والذرية الفُعيلة من قول القائل: ذرأ الله الخلق، بمعنى خلقهم فهو يذرؤهم، ثم ترك الهمزة فقيل: ذرا الله، ثم أخرج الفُعيلة بغير همز على مثال العُلِّية. وقد رُوي عن بعض المتقدمين أنه كان يقرأ: «مِنْ ذَرِيئَةِ قَوْمِ آخَرِينَ» على مثال فَعِيلَة. وعن آخر أنه كان يقرأ: «وَمِنْ ذُرْيَةِ» على مثال عُلْيَة. والقراءة التي عليها القرّاء في الأمصار: { ذُرّيَّة } بضمّ الذال وتشديد الياء على مثال عُلِّية. وقد بيَّنا اشتقاق ذلك فيما مضى قبل بما أغنى عن إعادته ههنا. وأصل الإنشاء: الإحداث، يقال: قد أنشأ فلان يحدّث القوم، بمعنى: ابتدأ وأخذ فيه.

2...
ومن تفسير القرطبي :


قوله تعالى: { وَرَبُّكَ ٱلْغَنِيُّ } أي عن خلقه وعن أعمالهم. { ذُو ٱلرَّحْمَةِ } أي بأوليائه وأهل طاعته. { إِن يَشَأْ يُذْهِبْكُمْ } بالإماتة والاستئصال بالعذاب. { وَيَسْتَخْلِفْ مِن بَعْدِكُمْ مَّا يَشَآءُ } أي خلقاً آخر أَمْثَلَ منكم وأطوع. { كَمَآ أَنشَأَكُمْ مِّن ذُرِّيَّةِ قَوْمٍ آخَرِينَ } والكاف في موضع نصب، أي يستخلف من بعدكم ما يشاء استخلافاً مثل ما أنشأكم، ونظيره :
{ إِن يَشَأْ يُذْهِبْكُمْ أَيُّهَا ٱلنَّاسُ وَيَأْتِ بِآخَرِينَ }
[النساء: 133].
{ وَإِن تَتَوَلَّوْاْ يَسْتَبْدِلْ قَوْماً غَيْرَكُمْ }
[محمد: 38].
فالمعنى يبدّل غيركم مكانكم، كما تقول: أعطيتك من دينارك ثوباً.

3...
ومن تفسير ابن كثير :


يقول تعالى: { وَرَبُّكَ } يا محمد { ٱلْغَنِىُّ } أي: عن جميع خلقه من جميع الوجوه، وهم الفقراء إليه في جميع أحوالهم، { ذُو ٱلرَّحْمَةِ } أي: وهو مع ذلك رحيم بهم، كما قال تعالى:
{ إِنَّ ٱللَّهَ بِٱلنَّاسِ لَرَءُوفٌ رَّحِيمٌ }[البقرة: 143]
{ إِن يَشَأْ يُذْهِبْكُمْ } أي: إذا خالفتم أمره { وَيَسْتَخْلِفْ مِن بَعْدِكُم مَّا يَشَآءُ } أي: قوماً آخرين، أي: يعملون بطاعته { كَمَآ أَنشَأَكُمْ مِّن ذُرِّيَّةِ قَوْمٍ ءَاخَرِينَ } أي: هو قادر على ذلك، سهل عليه، يسير لديه، كما أذهب القرون الأولى، وأتى بالذي بعدها، كذلك هو قادر على إذهاب هؤلاء والإتيان بآخرين، كما قال تعالى:
{ إِن يَشَأْ يُذْهِبْكُمْ أَيُّهَا ٱلنَّاسُ وَيَأْتِ بِئَـاخَرِينَ وَكَانَ ٱللَّهُ عَلَىٰ ذٰلِكَ قَدِيراً }
[النساء: 133] وقال تعالى:
{ يٰأَيُّهَا ٱلنَّاسُ أَنتُمُ ٱلْفُقَرَآءُ إِلَى ٱللَّهِ وَٱللَّهُ هُوَ ٱلْغَنِىُّ ٱلْحَمِيدُ إِن يَشَأْ يُذْهِبْكُـمْ وَيَأْتِ بِخَلْقٍ جَدِيدٍ وَمَا ذَلِكَ عَلَى ٱللَّهِ بِعَزِيزٍ }
[فاطر:15-17]. وقال تعالى:
{ وَٱللَّهُ ٱلْغَنِىُّ وَأَنتُمُ ٱلْفُقَرَآءُ وَإِن تَتَوَلَّوْاْ يَسْتَبْدِلْ قَوْماً غَيْرَكُمْ ثُمَّ لاَ يَكُونُوۤاْ أَمْثَالَكُم }
[محمد: 38]
وقال محمد بن إسحاق: عن يعقوب بن عتبه قال: سمعت أبان بن عثمان يقول في هذه الآية: { كَمَآ أَنشَأَكُمْ مِّن ذُرِّيَّةِ قَوْمٍ ءَاخَرِينَ } الذرية: الأصل، والذرية: النسل،

-------------

وأما تفسير الآية الثانية :
" إن يشأ يذهبكم ويأت بخلق جديد " فاطر 16 ...

1...
فمن تفسير الطبري :


يقول تعالـى ذكره: إن يشأ يُهلككم أيها الناس ربكم، لأن أنشأكم من غير ما حاجة به إلـيكم { ويَأْتِ بِخَـلْقٍ جَدِيدٍ } يقول: ويأت بخـلق سواكم يُطيعونه، ويأتـمرون لأمره، وينتهون عما نهاهم عنه، كما:
حدثنا بشر، قال: ثنا يزيد، قال: ثنا سعيد، عن قتادة، قوله: { إنْ يَشأْ يُذْهِبْكُمْ ويَأْتِ بِخَـلْقٍ جَدِيدٍ }: أي ويأت بغيركم.

وقوله: { وَما ذَلكَ علـى اللّهِ بِعَزِيزٍ } يقول: وما إذهابكم والإتـيان بخـلق سواكم علـى الله بشديد، بل ذلك علـيه يسير سهل، يقول: فـاتقوا الله أيها الناس، وأطيعوه قبل أن يفعل بكم ذلك.

2...
ومن تفسير القرطبي :


قوله تعالى: { إِن يَشَأْ يُذْهِبْكُـمْ } فيه حذف؛ المعنى إن يشأْ أن يذهبكم يذهبكم؛ أي يفنيكم. { وَيَأْتِ بِخَلْقٍ جَدِيدٍ } أي أطوع منكم وأزكى. { وَمَا ذَلِكَ عَلَى ٱللَّهِ بِعَزِيزٍ } أي ممتنع عسير متعذر. وقد مضى هذا في «إبراهيم».

< وأقول أنا أبو حب الله :
وهو هنا يقصد الآية 19 من سورة إبراهيم وقال فيها : >

وقوله: { إِن يَشَأْ يُذْهِبْكُمْ وَيَأْتِ بِخَلْقٍ جَدِيدٍ } { وَمَا ذَٰلِكَ عَلَى ٱللَّهِ بِعَزِيزٍ } أي: بعظيم ولا ممتنع، بل هو سهل عليه إذا خالفتم أمره أن يذهبكم ويأتي بآخرين على غير صفتكم؛

3...
ومن تفسير ابن كثير :

وقوله تعالى: { إِن يَشَأْ يُذْهِبْكُمْ وَيَأْتِ بِخَلْقٍ جَدِيدٍ } أي: لو شاء، لأذهبكم أيها الناس، وأتى بقوم غيركم، وما هذا عليه بصعب ولا ممتنع، ولهذا قال تعالى: { وَمَا ذَٰلِكَ عَلَى ٱللَّهِ بِعَزِيزٍ }.
-------
------------

وخلاصة القول كما ذكرت الأخت الفاضلة : طالبة علم وتقوى :

أن مَن يعتقد أن جميع الصفات الممكنة يجب أن تكون في التركيبة الجينية لآدم عليه السلام وحواء : فهذا بالطبع مستحيل إنما جيناتهما الحاملة لكل الإمكانيات هي من تجعل كل التركيبات متاحة مع استمرار نسل جنس الكائن على مر الأجيال " ..

أقول : وهذا هو بيت القصيد !!!!..

فالله تعالى وضع في كل الكائنات الحية أصول جينات كثيرة في أبويها :
وبتكرار التزاوج والتكاثر واختلاط الجينات من الأبوين مع كل جيل : يحدث التجدد والتنوع وإظهار الصفات التي قدرها الله تعالى في الكائنات الحية بحكمته ورحمته سبحانه (يعني مثلا ًلو آدم وحواء كانا أبيضين كما رأينا في المثال بالأعلى : فإنهما يحملان جينات قادرة على إخراج جيل أسمر البشرة أو أسود وجيل يتحمل الشمس أو البرد وأمراضهما إلخ) ..

ولذلك
:
يُنصح دوما ًبعدم التزاوج من داخل العائلة الواحدة أو تقليله بقدر الإمكان : حتى نعطي فرصة أكبر لاكتساب صفات جديدة مفيدة : وغلق الباب في وجه تكرار ظهور صفات مَرضية أو غير مرغوب فيها ..

وكذلك من رحمته عز وجل
:
أن التكاثر اللاجنسي غير منتشر في الحيوانات والفقاريات خصوصا ً.. ولا حتى التكاثر العذري أو البكري ((وهو الذي يكون من الأم فقط كما شرت منذ قليل)) .. لأنه لو كان الكل يتكاثر بهذه الصورة أو كان الأغلب هو ذلك : لما حدث أي تنوع جيني مع الوقت وتقليب وتبادل الصفات .. بل كل النسخ تكون مُكررة من الأم فتستمر في الضعف وعدم ظهور صفات مثلا ًلتقوية النسل ومقاومة لللأمراض أو مختلف الظروف البيئية إلخ ..

وإليكم صورة مبسطة للتبادل الجيني الوراثي بين الكروموسومات من الأب والأم عند الانقسام لتخرج لنا كروموسومات بنفس أماكن الجينات ولكن بتركيب مختلف (يعني مكان جين لون العين : هو نفسه على الكروموسوم لم يتغير مكانه ولكن اختلف تركيبه فتختلف الألوان الناتجة : وكذلك لون البشرة وفصائل الدم كما شرحنا إلخ) :

وهذه الصورة أيضا ًوالشكر للأخت طالبة علم وتقوى :


والكلام بصيغة أخرى : وبأسلوب مبسط لكل مَن يصعُب عليه فهم تفاصيل الجينات إلخ إلخ :

فإن الملحد الغير فاهم في العلوم الجينية - وكلهم كذلك - يعترض على المسلم فيقول :

كيف تنتج لنا ماكينة الطباعة الواحدة : كل الألوان المعروفة ؟!!!.. فهل يوضع فيها عبوات لكل الألوان المعروفة ؟!!!..
مستحيل !!!.. لأن هذا يعني أن في الطابعة الواحدة يكون هناك 16 ألف أو 32 ألف عبوة لون على الأقل !!!!..
رغم أن الطابعة نراها صغيرة الحجم : ولا مكان فيها أصلا ًلكل هذه العبوات !!!!..

ونحن نقول له :
يا هذا : لسنا في حاجة لوجود 16 ألف أو 32 ألف عبوة لون في الطابعة الواحدة الصغيرة !!!..
لأن الطابعة - وبكل بساطة - وعن طريق ثلاثة ألوان فقط (RGB) * أو أربعة (CMYK) ** :
يمكنها إنتاج أي درجة لون من هؤلاء الـ 16 ألف أو 32 ألف لون أو حتى مليون درجة لون :
عن طريق التحكم فقط في عملية المزج أو الخلط بين النسب المختلفة للثلاثة أو الأربعة ألوان !!!..

وهذه هي الحقيقة : للرد على هذه الشبهة المتهافتة للملحدين !!!..
فهم يتصورون - من كثرة تنوع الصفات البشرية - :
أنه على آدم وحواء أن يحملان كل هذه الملايين أو المليارات من الصفات بداخل جيناتيهما :
ثم يبتسمون لك بابتسامة جهلاء بلهاء وهم يقولون لك : وهذا بالطبع مستحيل !!!..

حينها : نذكر لهم مثال الطابعة الألوان هذا : وتأكد أنهم بعدها : لن يتحدثوا في هذه النقطة مرة ثانية معك !
-----------

* - نظام الألوان RGB :
هو اختصار للألوان الثلاثة { Red - Green - Blue } أي :
{ الأحمر - الأخضر - الأزرق } : كثلاثة ألوان رئيسية في تشكيل كافة الألوان الأخرى :
وذلك عن طريق مزج هذه الألوان الثلاثة بنسب مختلفة : عن طريق (إضافتها) على خلفية سوداء :
وكما تشاهدون في يسار الصورة القادمة (ولاحظوا تكون اللون الأبيض أيضا ًفي المنتصف) :



** - وأما نظام الألوان CMYK :
فهو اختصار للألوان الأربعة { Cyan - Magenta - Yellow - Black } أي :
{ الأزرق السماوي ( سيان ) - والأحمر الأرجوانيّ ( ماجينتا ) - الأصفر - الأسود } :
حيث يتم مزج هذه الألوان أيضا ًبنسب مختلفة : للحصول على باقي الألوان المعروفة ..
وذلك عن طريق (طرحها) من خلفية بيضاء .. وذلك كما في منتصف الصورة السابقة ..

وأخيرا ً- ومعلومة جانبية لمَن يهمه الأمر - :
يُستخدم نظام الألوان RGB في الطابعات المكتبية والمنزلية البسيطة كما في نوع الإنك جيت Ink Jet :
كذلك غالبا ًفي شاشات العرض المختلفة ...
وأما نظام الألوان CMYK : فيستخدم في حال الطباعات المحترفة في الأوراق والبوسترات والمطابع الكبرى إلخ

والله الموفق ...

__________________


<< حضور متقطع >>
حوار مع مسلم - اضغط هنا
ما يجب أن تعرفه عن نظرية التطور - اضغط هنا
هدم أسس الإلحاد - اضغط هنا
مدونتي - اضغط هنا
فرق ومذاهب وأحزاب وأديان معاصرة - اضغط هنا
إلى كل نصراني - اضغط هنا
فضح جهالات المدعو عمر المناصير - اضغط هنا
حقيقة المجوس الشيعة الروافض - اضغط هنا
عقد الضفيرة على شانئي أبي هريرة - اضغط هنا
الثورة المصرية .. وعقول ٌسلفية - اضغط هنا
رد مع اقتباس
  #116  
قديم 2012-09-26, 02:44 PM
أبو حب الله أبو حب الله غير متواجد حالياً
محـــاور
 
تاريخ التسجيل: 2011-10-24
المشاركات: 305
افتراضي


متفرقات ....
الحفرية إيدا Ida هل تثبت تطور الإنسان ؟؟؟..

سألتني أخت فاضلة عن تلك الحفرية .. فأجيبها بالجواب التالي :
ثم بعدها مباشرة ًمن المشاركة القادمة أبدأ في الحديث عن التصميم الذكي ...
والله المستعان ..
------

أقول ...

كثيرا ًما نلاحظ أن حفريات معينة يتحصل عليها الداروينيين والملاحدة والتطوريين ...
وتظل عادية عندهم - لأنها فعلا ًعادية - ...
إلى أن تأتي فترات هزات زلزالية قوية لنظريتهم الساقطة : فساعتها فقط :
فبدأون ساعتها في إخراج أمثال هذه الحفريات العادية للنور : ومصحوبة بضجة إعلامية يكون مفادها أن تلك الحفرية أو ذاك :
تثبت التطور !!!!..

وفي الحفرية إيدا هنا أتساءل :
ما الغريب - أو الجديد - في أن يتم اكتشاف حفرية قرد قديم ؟؟؟...



وسواء إيدا أو غيرها - أي لو تم اكتشاف حفرية أي قرد قديم - :
فهل كنا نتوقع شيئا ًآخرا ًمن الداروينيين والملاحدة والتطوريين غير أن يدعوا أنها جد الإنسان والقرد (أو عمتهم أو حتى خالتهم : فالعائلة المباركة عند أحفاد القردة واحدة) ؟!!..
هل كنا نتوقع منهم غير ذلك ؟؟؟...



فهذه القردة (الليموريات) أو حتى لو افترضنا أنها شبيهة بالليموريات إلخ :
ما الجديد فيها الذي ينفي معضلات التطور إلى الإنسان ؟؟!!!..
ألا تلاحظون معي أن نفس الاستحالات والأسئلة التي بلا أجوبة : هي هي لم تتغير ؟؟؟؟..

انظروا إلى الذيل الطويل الذي خلقه الله لتلك القرود للتعلق به على أغصان الشجر ؟!!..
وانظروا إلى أصابع قدميها الطويلة كأصابع اليد .. وأيضا ًانظروا لطول الأصبع الإبهام ؟!!..



فهذه القردة الأنثى التي طولها 58 سم .. والتي ماتت وعمرها عام تقريبا ً:
تم اكتشافها أصلا ًمنذ عام 1983م !!!.. ولم يُـفتعل أي ضجة ساعتها .. إلا منذ 3 سنوات فقط تقريبا ً!!!..
أي بعد أكثر من 25 عام تقريبا ً!!!!.. فلماذا في تلك الفترة تحديدا ًيا ترى قام التطورييون بتقليب دفاترهم القديمة ومتاحفهم ؟؟؟..
هل كان ذلك ردا ًعلى تحديهم بأن يحضروا حفرية انتقالية واحدة والذي فشلوا فيه إلى اليوم ؟؟؟؟..
فما أغباهم وما أغبى مَن يصدقهم ساعتها إن ظنوا أن هذه القردة القديمة هي حفرية انتقالية !!!..
وسبحان الله العظيم ...

وأما عن معضلات واستحالة تطور القرود أو سلفها إلى الإنسان :
فتجدون تفاصيله في رابط المشاركة الهامة جدا ًالتالي :
http://abohobelah.blogspot.com/2012/06/1.html

والله الموفق ...
__________________


<< حضور متقطع >>
حوار مع مسلم - اضغط هنا
ما يجب أن تعرفه عن نظرية التطور - اضغط هنا
هدم أسس الإلحاد - اضغط هنا
مدونتي - اضغط هنا
فرق ومذاهب وأحزاب وأديان معاصرة - اضغط هنا
إلى كل نصراني - اضغط هنا
فضح جهالات المدعو عمر المناصير - اضغط هنا
حقيقة المجوس الشيعة الروافض - اضغط هنا
عقد الضفيرة على شانئي أبي هريرة - اضغط هنا
الثورة المصرية .. وعقول ٌسلفية - اضغط هنا
رد مع اقتباس
  #117  
قديم 2012-10-29, 08:24 AM
الرحباني الرحباني غير متواجد حالياً
عضو جديد بمنتدى أنصار السنة
 
تاريخ التسجيل: 2012-06-21
المشاركات: 3
افتراضي

بارك الله فيك استاذ ابو حب الله على هذه المواضيع المفتتة لنظرية التطور الخرافية ..

لكن اريد ان استأذنك في أمر ما ..

هل تسمح لي أو لأي شخص أن يقوم بجمع هذه المادة الوفيرة في نقد التطور وحفظها على هيئة كتاب اليكتروني PDF ؟؟

بارك الله فيكم ..
رد مع اقتباس
  #118  
قديم 2012-11-01, 12:23 AM
أبو حب الله أبو حب الله غير متواجد حالياً
محـــاور
 
تاريخ التسجيل: 2011-10-24
المشاركات: 305
افتراضي

[align=center]
اقتباس:
المشاركة الأصلية كتبت بواسطة الرحباني مشاهدة المشاركة
بارك الله فيك استاذ ابو حب الله على هذه المواضيع المفتتة لنظرية التطور الخرافية ..
لكن اريد ان استأذنك في أمر ما ..
هل تسمح لي أو لأي شخص أن يقوم بجمع هذه المادة الوفيرة في نقد التطور وحفظها على هيئة كتاب اليكتروني PDF ؟؟
بارك الله فيكم ..
أولا ً: أعتذر عن تأخر الرد أخي الكريم ...
وثانيا ً: أشكر لك حسن ظنك بأخيك ..
وثالثا ً:
لا مانع عندي مما اقترحته .. وإن كنت أرغب في إعادة ترتيب محتوى الموضوع بصورة أكثر تسلسلا ًلضمان قوة العرض ..
ولكن في الصورة الموجودة حاليا ًالكفاية أيضا ًلأنه يبدو أني سأتأخر في جمعها بالصورة التي أريد للانشغال الشديد ..
فشيء : أفضل من لا شيء .. وما لا يُدرك كله : لا يُترك جله كما يقولون ..
ولكن :
حبذا لو يتم عملها في شكل إصدارات مرقمة : 1 , 2 , 3 وهكذا : ومع كل إصدار تاريخه بالشهر والعام ..
أي على صورة طبعات كل فترة : حيث يتم في كل إصدار جديد : إضافة ما أضعه من مشاركات حديثة به ..
وذلك ليكون القاريء والمتابع على علم بالأحدث من الأقدم من إصدارات الموضوع ...

وفقكم الله إلى كل خير ..
والدال على الخير : له مثل أجر فاعله بإذن الله تعالى ..
والله المستعان ...
[/align]
__________________


<< حضور متقطع >>
حوار مع مسلم - اضغط هنا
ما يجب أن تعرفه عن نظرية التطور - اضغط هنا
هدم أسس الإلحاد - اضغط هنا
مدونتي - اضغط هنا
فرق ومذاهب وأحزاب وأديان معاصرة - اضغط هنا
إلى كل نصراني - اضغط هنا
فضح جهالات المدعو عمر المناصير - اضغط هنا
حقيقة المجوس الشيعة الروافض - اضغط هنا
عقد الضفيرة على شانئي أبي هريرة - اضغط هنا
الثورة المصرية .. وعقول ٌسلفية - اضغط هنا
رد مع اقتباس
  #119  
قديم 2012-11-04, 12:03 PM
أبو حب الله أبو حب الله غير متواجد حالياً
محـــاور
 
تاريخ التسجيل: 2011-10-24
المشاركات: 305
افتراضي


فضيحة الويكيبديا والتطور ...

بقلم أبو حب الله ..

وفي النهاية ......... تم حذف الصفحة أخيرا ًبالأمس ..
وكما توقعت وخططت هنا :
http://www.eltwhed.com/vb/showthread...8%CF%ED%C7-%BF

وكما بدأت أيضا ًفي رصد رد فعل غيظ القوم وحنقهم هنا :
http://www.eltwhed.com/vb/showthread...%CA%E5%E6%D1-)

حيث لم يحتمل عبيد داروين والتطور بأنواعه هذه الغصة في حلوقهم ولو شهرا ًواحدا ً:
لا .. وأين ؟؟.. بين جنبات صرحهم اللاحيادي في التطور والإلحاد :
الويكيبديا .................. >> سأجعلها الفضيحيبديا
:)):

والتي تمتليء مواضيعها البيولوجية بمئات الأغاليط والأخبار المكذوبة بل :
والأخبار التي ما زالت باقية بغير تغيير : رغم نفي العلم تجريبيا ًلها :
مثل الجانك جين مثلا ًوبقايا التطور المزعومة في الأعضاء الضامرة ...
على العموم ...
مشروعي في وضع صفحة على غرار الويكيبديا لفضح التطور : سأكمله بإذن الله تعالى ...
ويا لحسن الحظ : لدي البديل والحمد لله عن هذه الويكيبديا عميلة التطور ومرتع الملاحدة ..
وأما الفضيحة :
فسوف أنشرها في موضوعي :
ما يجب أن تعرفه عن نظرية التطور : ولينتشر معه في المنتديات بإذن الله :
وليبقى دليلا ًأمام كل غر ساذج مخدوع بالويكيبديا في أكاذيبها التطورية التي تملأ مواضيعها ..

وهذه هي آخر صورة للصفحة :



وهذه صورة مربع الكلام بعد التكبير لرؤية مبرراتهم المفضوحة :
والتي سترون عكسها في الموضوع كما سيأتي ..



حيث لم يجد هذا النيوتن - صاحب المحاولة الجنونية من قبل لتغيير مقدمة الموضوع :
والتعرض للدين فيها والدعاة والشيوخ : رغم أني لم أذكر كلمة دين قط !
- أقول :
لم يجد هذا النيوتن مأخذا ًعلى الموضوع - بجانب أكاذيبه وافتراءاته أنه غير علمي - :
إلا الرابط رقم 2 الذي وضعته :
http://www.texscience.org/reports/sb...e-2009feb7.htm

وفيه دفاع أحد كتاب التطور عن شجرة الحياة لحفظ ماء الوجه بعد فضيحة التليجراف في الرابط رقم 1 :
http://www.telegraph.co.uk/science/4...cientists.html

حيث رغم أنه يعترف بخطأ شجرة حياة داروين :
إلا أنه - وكتطوري عنيد - يعزي ذلك لنقص المعلومات الجينية في عصره وغيرها ..!

والحقيقة :
أن ما أورده هذا الكاتب التطوري من معلومات جديدة وشجرة حياة جينية حديثة :
تسخر من هؤلاء القوم وتبين لنا ولكل عاقل : كم يضحكون على أنفسهم !!!..
لأنها تعبث بالتدرج (الواضح) المفترض وجوده حسب نظريات التطور :
فضلا ًعن إثبات علم الجينات اليوم :
كمّ أن كل كائن حي : هو فريد جينيا ًعن أقرب الكائنات شبها ًإليه حتى !!!..

والآن ...
أترككم مع نص مقالي المحذوف من الويكيبديا ...

__________________


<< حضور متقطع >>
حوار مع مسلم - اضغط هنا
ما يجب أن تعرفه عن نظرية التطور - اضغط هنا
هدم أسس الإلحاد - اضغط هنا
مدونتي - اضغط هنا
فرق ومذاهب وأحزاب وأديان معاصرة - اضغط هنا
إلى كل نصراني - اضغط هنا
فضح جهالات المدعو عمر المناصير - اضغط هنا
حقيقة المجوس الشيعة الروافض - اضغط هنا
عقد الضفيرة على شانئي أبي هريرة - اضغط هنا
الثورة المصرية .. وعقول ٌسلفية - اضغط هنا
رد مع اقتباس
  #120  
قديم 2012-11-04, 12:04 PM
أبو حب الله أبو حب الله غير متواجد حالياً
محـــاور
 
تاريخ التسجيل: 2011-10-24
المشاركات: 305
افتراضي

[h=1]صعوبات نظرية التطور[/h]


صعوبات نظرية التطور ما زالت أحد العوائق في انتشار هذه النظرية بين الكثير من دول العالم بعد نشأتها في صورتها الحديثة على يد داروين في كتابه أصل الأنواع الذي صدر 1859م , وفي هذا الموضوع سنستعرض معا طائفة من هذه الصعوبات سواء تلك التي اعترف بها داروين في كتابه بنفسه كما سيأتي , ثم أثبت العلم الحديث فعلا خطأها مثل سقوط منظومة شجرة الحياة المفترضة لتطور الكائنات [SUP][1][/SUP] [SUP][2][/SUP] أو سواء تلك الصعوبات التي أثارت أخطاؤها استياء بعض الجهات التعليمية حديثا فقامت بإزالتها مثلما حدث في كوريا الجنوبية مؤخرا [SUP][3][/SUP]

محتويات

[LIST=1][*]اعتقاد داروين بفكرة توريث الصفات المكتسبة[*]اشتقاق داروين لفكرة الانتخاب الطبيعي من الانتخاب الصناعي أو البشري[*]اعتراف داروين بمشكلة عدم وجود حفريات انتقالية على غير المتوقع وفق النظرية[*]اعتراف داروين بالتعقيد التشريحي في أعضاء الكائنات الحية[*]أدلة غير صحيحة على التطور[/LIST]

[TABLE="class: toc"]
[TR]
[TD]
[h=2]محتويات[/h] [أخف]
[LIST][*]1 1. اعتقاد داروين بفكرة توريث الصفات المكتسبة[*]2 2. اشتقاق داروين لفكرة الانتخاب الطبيعي من الانتخاب الصناعي أو البشري[*]3 3. اعتراف داروين بمشكلة عدم وجود حفريات انتقالية على غير المتوقع وفق النظرية[*]4 4. التعقيد التشريحي في أعضاء الكائنات الحية[*]5 5. أدلة غير صحيحة على التطور[/LIST][/TD]
[/TR]
[/TABLE]
[h=2][عدل]1. اعتقاد داروين بفكرة توريث الصفات المكتسبة[/h][LIST][*]وهي الفكرة التي اشتهر بها من قبله لامارك حينما اعتقد بأن التغييرات التي تحدث في حياة الكائن الحي هي نتيجة استخدامه / أو عدم استخدامه لبعض أعضائه أو تحورها ثم انتقالها إلى أبنائه ويتم توريثها لهم - وساق مثاله الشهير عن استطالة عنق الزرافة - وهي الفكرة التي رفضها بعد ذلك العلم الحديث مع الطفرة التي أحدثها العالم مندل في قوانين الوراثة , ومع التأكد بأن المسؤول عن وراثة الصفات هي الخلايا الجنسية وليست الجسدية , وهو ما أثبته عمليا أيضا العالم وايزمان[[1]] عندما قام بقطع ذيول عشرات الفئران لأكثر من جيل فكانت النتيجة في كل مرة أنهم يلدون من جديد فئرانا بذيول . أيضا تجربة الباحثين كاسل وفيلبس عام 1909 حيث قاما بإزالة مبيض أنثى خنزير غينيا Guinia Pig بيضاء اللون، وزرعا مكانه مبيض أنثى سوداء اللون. ثم قاما بتلقيح هذه الأنثى البيضاء بذكر أبيض، فكان الجيل الناتج أسود اللون، مما يعني أن صفة اللون قد اكتسبت من خلال لون الأنثى السوداء التي تم زرع مبيضها في الأنثى البيضاء، وهذا المبيض هو الذي يحتوي على الخلايا الجنسية التي انتقلت عبرها صفة اللون , فماذا كان يقول داروين عن انتقال الصفات المكتسبة بالتوريث ؟[/LIST]

[LIST][*]نطالع في الباب الأول من كتاب أصل الأنواع باسم التمايز تحت تأثير التدجين Variation under demostication وتحت العنوان الثاني من الباب وهو تأثيرات السلوك Efficts of Habits قول داروين ومن أول سطر :[/LIST]"السلوكيات التي تتغير تحدث تأثيرا وراثيا , ومثال ذلك ما يحدث في الفترة التي تزهر فيها النباتات عندما تنقل من مناخ إلى مناخ آخر , أما في الحيوانات فإن الزيادة في استخدام أو عدم استخدام الأجزاء قد كان له تأثير أكثر وضوحا " [SUP][4][/SUP]
ومثل هذا الإيمان الخاطيء من داروين بتوريث الصفات المكتسبة , قد أثر على أحد أعمدة نظرية التطور في تخيل ورسم سيناريوهات تطور الكائنات الحية الموجودة حاليا , ليس في ذهن وخيال داروين فقط وافتراضاته ولكن في ذهن وخيال أيضا كل من أتى بعده ويحمل على عاتقه فكرة التطور بصورة أو بأخرى .



[LIST][*]فأما بالنسبة لداروين , وفي الوقت الذي بقيت فيه بعض أمثلته التي ساقها على توريث الصفات المكتسبة في كتابه إلى اليوم , مثل تلك التي في نفس موضع الاستشهاد من الباب الأول الذي ذكرناه منذ قليل - مثل البط الداجن قليل الطيران [SUP][5][/SUP] ومثل أثداء الأبقار والماعز في المناطق الكثيرة الحلب لها [SUP][6][/SUP] ومثل تدلي آذان بعض الحيوانات الداجنة [SUP][7][/SUP] إلخ - إلا أن البعض لا يعرف أنه هناك مثال بارز جدا أيضا على إيمان داروين بتوريث الصقات المكتسبة , ولكن هذا المثال تم حذفه بعد ذلك للأسف من الطبعات اللاحقة لكتابه أصل الأنواع .. حيث صرح فيه داروين صـ 184 وتعليقا على مشاهدة صديقه للدب الأسود يعوم لساعات في أمريكا الشمالية فاتحا فمه ليصطاد الحشرات مثلما يفعل الحوت , فقال داروين :[/LIST]" أنه لا يجد أي صعوبة في تخيل نوع من الدببة وبمزيد من السلوكيات البحرية في حياتها ومزيد من اتساع فمها ومع الانتخاب الطبيعي , أن تصبح يوما ما مخلوقا في حجم الحوت الضخم "
والنص بالإنجلزية :
In North America the black bear was seen by Hearne swimming for hours with widely open mouth, thus catching, like a whale, insects in the water. Even in so extreme a case as this, if the supply of insects were constant, and if better adapted competitors did not already exist in the country, I can see no difficulty in a race of bears being rendered, by natural selection, more and more aquatic in their structure and habits, with larger and larger mouths, till a creature was produced as monstrous as a whale. [SUP][8][/SUP]



[LIST][*]وأما نفس التأثير للإيمان بتوريث الصفات المكتسبة على مَن أتوا بعد داروين ويحملون نفس أفكار نظرية التطور التدريجي في الكائنات الحية , فعن حياة الحيتان أيضا نجد نفس الفكرة الداروينية مسيطرة وكما في كتاب "استكشاف حياة الحيتان" [SUP][9][/SUP] حيث نقرأ فيه :[/LIST]" بدأ تطور الحوت إلى حجمه الحالي قبل ستين مليون سنة , عندما غامرت الحيوانات الثديية البرية ذات القوائم الأربع والشعر بالتحول إلى الماء بحثاً عن الغذاء , وعلى مر العصور طرأت التغيرات تدريجياً , فاختفت القوائم الخلفية , وتحولت القوائم الأمامية إلى زعانف , كما اختفى الشعر ليتحول إلى جلد سميك لين الملمس , وتحولت فتحات الأنف نحو أعلى الرأس , وتغير شكل الذيل ليصبح أكثر تفلطحاً , ثم بدأ جسمه يكبر جداً داخل الماء "


[LIST][*]وهكذا وعلى التوالي تظهر نفس الفكرة في محاولات التطوريين أيضا لتخيل أو افتراض تطور الكائنات الحية على أساس توريث الصفات التي اكتسبها الكائن في حياته , حيث نطالع ما نقلته لنا مجلة ناشيونال جيوغرافيك في عددها الخمسين في تفسير بدء ظاهرة الإرضاع باللبن :[/LIST]" شرعت بعض الزواحف التي عاشت في المناطق الباردة في تطوير أسلوب للحفاظ على حرارة جسمها , وكانت حرارتها ترتفع في الجو البارد , وانخفض مستوى الفقد الحراري عندما أصبحت القشور التي تغطي جسمها أقل , ثم تحولت إلى فرو , وكان إفراز العرق وسيلة أخرى لتنظيم درجة حرارة الجسم , وهي وسيلة لتبريد الجسم عند الضرورة عن طريق تبخر المياه . وحدث بالصدفة أن صغار هذه الزواحف بدأت تلعق عرق الأم لترطيب نفسها , وبدأت بعض الغدد في إفراز عرق أكثر كثافة , تحول في النهاية إلى لبن , ولذلك حظي هؤلاء الصغار ببداية أفضل لحياتهم " [SUP][10][/SUP]


[LIST][*]وبالطبع في الكلام السابق - وبجانب الخطأ العلمي في توريث الصفات المكتسبة - فهناك خطأ ظاهر آخر وهو ادعاء قدرة الكائن الحي على التغيير من خصائص جسده لتتحور للتكيف مع بيئته , حيث وبعد اكتشاف عالم الحمض النووي والشيفرات الوراثية الباهر والمعقد جدا صار معروفا أن كل صفة جسدية من صفات الكائن الحي يقابلها ترجمة جينية على الشريط الوراثي , وطالما لم يدعي أحد أن كائنا ما يستطيع التغيير أو التحرير أو التعديل في شيفرته الوراثية في خلاياه , فصارت مثل هذه الأفكار عن التحور لا تقم على أساس علمي , ونختم هنا بمثال آخر عن التحور وتوريثه للأبناء , وهو لعالم التطور التركي علي ديمرسوي Ali Demirsoy [SUP][11][/SUP] حيث يقول عن ظهور أرجل من ذيول الأسماك :[/LIST]" ربما تكون ذيول الأسماك التي تحتوي على رئة , قد تحولت إلى أرجل للبرمائيات عندما زحفت هذه الأسماك في ماء فيه وحل "
والنص باللغة الإنجليزية :
"Maybe the fins of lunged fish changed into amphibian feet as they crept through muddy water."



[h=2][عدل]2. اشتقاق داروين لفكرة الانتخاب الطبيعي من الانتخاب الصناعي أو البشري[/h][LIST][*]حيث عندما حاول داروين وضع آلية للتطور حسب رؤيته وملاحظاته للكائنات الحية التي شاهدها في رحلاته وحياته . فقد اختار فكرة الانتخاب الطبيعي . ورغم أن فكرة الانتخاب الطبيعي قد تعطينا صورة لكيفية البقاء للأصلح , إلا أنها لا تفسر لنا أبدا كيفية ظهور ذلك الأصلح نفسه وصفاته المختلفة عن باقي نوعه والتي أهلته للبقاء .[/LIST]أيضا اعتمد داروين في إمكانية التطور حسب افتراضه على ما رآه من عمليات تهجين المزارعين وخصوصا في حيواناتهم الداجنة , وكيف يقومون باصطفاء واختيار وإبراز أفضل صفات أنواع الحيوانات باستنسالها . فخلع على الطبيعة صفات الانتقائية والعلم والملاحظة , وهو مخالف قطعا للمعروف عنها علميا وتجريبيا , وهذا ما جعل التدليل على صحة الانتخاب الطبيعي كآلية للتطور غير متحققة تجريبيا إلى اليوم , وحتى محاولة تعليق عدم التحقق بأنها تحتاج إلى فترات زمنية طويلة لتظهر آثارها تعد بملايين السنين , فهذا أيضا ينافي فرضية أن كل تغيير كبير في الكائن الحي وأعضائه بالصورة التي تنتج لنا نوعا جديدا في سلم التطور وشجرته المفترضة , يجب أن ينشأ صغيرا مع الوقت وبسيطا ثم يزداد في التعقيد وكبر الحجم , وهذا الصغر في الحجم في بدايته - ومع عدم تحقيقه لفائدة منه في أول ظهوره - كفيل بأن يستقصيه الانتخاب الطبيعي لعدم أهميته في صراع البقاء على مدى ملايين السنين .


[LIST][*]ولهذا لم يجد داروين بدا من القول بهذا التداخل الذي يجده القاريء في كلامه عن الانتخاب الطبيعي وكأنه انتخاب صناعي أو بشري حيث يقول :[/LIST]For brevity sake I sometimes speak of natural selection as an intelligent power in the same way as astronomers speak of the attraction of[SUP][12][/SUP]gravity as ruling the movements of the planets, or as agriculturists speak of man making domestic races by his power of selection
[LIST][*]ويقول أيضا :[/LIST]
The key is man's power of accumulative selection: nature gives successive variations; man adds them up in certain directions useful to him [SUP][13][/SUP][LIST][*]ويقول كذلك :[/LIST]If feeble man can do much by his powers of artificial selection, I can see no limit to the amount of change, to the beauty and infinite complexity of the coadaptations between all organic beings, one with another and with their physical conditions of life, which may be[SUP][14][/SUP]effected in the long course of time by nature's power of selection
[LIST][*]وقد تنبه إلى تلك المعاني الهامة ستيفن جولد Stephen Gould معتبرا إياها خللا في آلية الانتخاب الطبيعي وذكرها في كتابه عن داروين حيث قال :[/LIST]
The principle of natural selection depends upon the validity of an analogy with artificial selection [SUP][15][/SUP]

[h=2][عدل]3. اعتراف داروين بمشكلة عدم وجود حفريات انتقالية على غير المتوقع وفق النظرية[/h][LIST][*]حيث تطالعنا هذه الحقيقة الهامة في أول الباب السادس من كتاب داروين أصل الأنواع , والذي خصصه بنفسه لذكر الصعوبات التي تواجه نظريته , حيث سماها : " انعدام أو ندرة وجود الضروب الانتقالية " [SUP][16][/SUP][/LIST]سواء الضروب الانتقالية الحية المفترض وجودها بين الكائنات الحية إلى اليوم من حولنا في كل مكان كبقايا للتطور , أو سواء حفريات لتلك الضروب الانتقالية بين الأنواع المختلفة في الماضي , والمفترض أن تكون بأعداد هائلة في طبقات الأرض , حيث يعلق داروين على تلك الصعوبات بنفسه قائلا :
" والبعض منها صعوبات في منتهى الجدية , إلى درجة أني إلى هذا اليوم أجد صعوبة في إمعان التفكير فيها بدون الشعور بدرجة ما من الذهول " [SUP][17][/SUP]

وذكر في أولها نقطة انعدام وجود تلك الضروب الانتقالية بقوله :
" إذا كانت الأنواع قد نشأت وانحدرت من أنواع أخرى عن طريق تدرجات دقيقة , فلماذا لا نستطيع أن نرى في كل مكان عددا لا حصر له من الأشكال الانتقالية , ولماذا لا تكون الطبيعة كلها في حالة من الفوضى , بدلا مما نراه من كون الأنواع محددة بدقة " [SUP][18][/SUP]



[LIST][*]بل ووصل الأمر بداروين أن استنتج منطقيا عدم صحة نظريته إذا لم توجد هذه الأدلة من الأشكال الانتقالية بكثرة في طبقات الأرض وحفرياتها , فيقول :[/LIST]" وأخيرا , فبالنظر إلى مجموع الزمن وليس لأي زمن واحد , وإذا كانت نظريتي صحيحة , فإنه من المحتم أنه كانت توجد هناك أعداد لا حصر لها من الضروب المتوسطة , تربط فيما بين جميع الأنواع التابعة لنفس المجموعة , ولكن عملية الانتقاء الطبيعي ذاتها تميل بشكل ثابت , كما ثبت التنويه عن ذلك في أحوال كثيرة , إلى إبادة الأشكال الأبوية والحلقات الوسطية , وبالتالي فإن الدليل على وجودهما السابق من الممكن العثور عليه فقط بين البقايا الأحفورية التي نجدها محفوظة , كما سوف نحاول أن نظهره في باب قادم , في شكل سجل منقوص متقطع إلى أقصى حد " [SUP][19][/SUP]


[LIST][*]وقد ظلت هذه العقبة تعترض التحقق من نظرية داروين منذ نشأتها وإلى اليوم , ولم تزدها كثرة الاكتشافات الأحفورية إلا تعقيدا , ويلخص لنا هذه الإشكالية عالم الأحياء Francis Hitching فيقول :[/LIST]" إذا كنت نظرية دارون صحيحة , ولو وجدنا حفريات بالفعل , لا بد وأن تحتوي الصخور على حفريات لكائنات متدرجة بشكل دقيق جدا , حيث من المفترض أن تتدرج من مجموعة من الكائنات إلى مجموعة أخرى بمستوى أعلى من التعقيد , ولا بد وأن نجد حفريات توضح الفروق الطفيفة بين الكائنات الانتقالية المختلفة , وذلك بكمية وبوضوح مماثل للحفريات التي وُجِدَت للأنواع المختلفة المُحَدَّدة , ولكن ليس ذلك هو الوضع في الواقع , بل الواقع هو العكس , وهذا ما اشتكى منه دارون نفسه ..... حيث على الرغم من أنه وفقا لهذه النظرية لا بد وأن تكون هناك كائنات انتقالية لا حصر لها , فلماذا لا نرى هذه الكائنات مطمورة بأعداد كبيرة في قشرة الأرض ؟
وقد شعر دارون أن المسألة ستُحَلّ بإيجاد مزيد من الحفريات , والواقع أنه كلما تم العثور على حفريات جديدة , كلما وجدناها كلها دون استثناء , قريبة جدا للكائنات التي تعيش حاليا "

والنص باللغة الإنجليزية :
If we find fossils, and if Darwin's theory was right, we can predict what the rock should contain; finely graduated fossils leading from one group of creatures to another group of creatures at a higher level of complexity. The 'minor improvements' in successive generations should be as readily preserved as the species themselves. But this is hardly ever the case. In fact, the opposite holds true, as Darwin himself complained; "innumerable transitional forms must have existed, but why do we not find them embedded in countless numbers in the crust of the earth?" Darwin felt though that the "extreme imperfection" of the fossil record was simply a matter of digging up more fossils. But as more and more fossils were dug up, it was found that almost all of them, without exception, were very close to current living animals [SUP][20][/SUP]



[LIST][*]وقد اعترف علماء التطور والداروينية أنفسهم بهذه الصعوبات والعوائق , حيث يقول مثلا عالم الحفريات المؤيد للتطور في جامعة هارفارد Stephen Jay Gould في أواخر السبعينات قائلا ً:[/LIST]" إن تاريخ معظم الحفريات يحتوي على صفتين لا تتماشيان مع التدرج في إيجاد الكائنات الحية :
[LIST=1][*]الأولى : هي الاتزان والاستقرار , حيث لا تتغير طبيعة الكائنات طوال مدة بقائها على الأرض , فالكائنات الموجودة في سِجِلّ الحفريات تظهر وتختفي كما هي دون حدوث تغيرات عليها , وإن حدثت تغيرات فإنها تكون تغيرات طفيفة وفي الشكل الخارجي , وليست باتجاه أي تطور .[*]الصفة الثانية , وهي الظهور المفاجئ , حيث في أي منطقة , لا تنشأ الأنواع الجديدة تدريجيا منحدرة من كائنات أخرى , وإنما تظهر فجأة , و بتركيب مكتمل تماما "[/LIST]والنص باللغة الإنجليزية :
The history of most fossil species include two features particularly inconsistent with gradualism: 1) Stasis - most species exhibit no directional change during their tenure on earth. They appear in the fossil record looking much the same as when they disappear; morphological change is usually limited and directionless; 2) Sudden appearance - in any local area, a species does not arise gradually by the steady transformation of its ancestors; it appears all at once and 'fully formed'. [SUP][21][/SUP]



[LIST][*]وأيضا يقول عالم الحفريات الدارويني التطوري Robert Carroll بأن أمل دارون لم يتحقق بالحفريات فيقول :[/LIST]" على الرغم من البحث الكثيف لأكثر من مائة عام بعد موت دارون , إلا أن الاكتشافات الحفرية لا تكشف عن الصورة المتكاملة من الكائنات الانتقالية التي توقعها دارون "
والنص باللغة الإنجليزية :
Despite more than a hundred years of intense collecting efforts since the time of Darwin's death, the fossil record still does not yield the picture of infinitely numerous transitional links that he expected. [SUP][22][/SUP]



[LIST][*]وأيضا ًالعالم K. S. Thomson وهو عالم حفريات آخر مؤيد للدارونية , يقول بأنه من خلال دراسة تاريخ الكائنات التي عاشت على الأرض من خلال سجل الحفريات , فإن أي مجموعة جديدة من الكائنات الحية تم اكتشاف حفريات لها , كانت تظهر بشكل مفاجئ وغير مترابط مع أي كائنات حية أخرى , يقول :[/LIST]" عندما تظهر مجموعة كبيرة من الكائنات الحية في السجل , فإنها تكون مجهزة تماما بصفات جديدة , وليست موجودة في الكائنات المتعلقة بها , ويبدو أن هذه التغيرات الجذرية في الشكل الخارجي والوظيفة , تظهر بسرعة جدا ....."
والنص باللغة الإنجليزية : When a major group of organisms arises and first appears in the record, it seems to come fully equipped with a suite of new characters not seen in related, putatively ancestral groups. These radical changes in morphology and function appear to arise very quickly… [SUP][23][/SUP]


[LIST][*]وحتى على مستوى المايكروبيولوجي والدراسات الجينية للحمض النووي للكائنات الحية نجد تلك الصعوبات ماثلة أيضا وليس في الحفريات فقط , وفي ذلك يقول البروفيسور مايكل دانتون أحد أبرز العلماء المشهورين في علم الأحياء المجهرية (Microbiology) :[/LIST]" في عالم الجزيئات والأحياء المجهرية , لا يوجد هناك كائن حي يُعَدُّ جدًّا لكائن آخر , ولا يوجد هناك كائن أكثر بدائية أو أكثر تطوراً من كائن آخر " [SUP][24][/SUP]


[LIST][*]وعلى هذا نقترب من خط فاصل يعرض نظرية التطور للحرج الشديد , حيث يقول داروين في كتابه أصل الأنواع :[/LIST]" إذا كانت الأنواع الكثيرة , والتي تنتمي إلى نفس الأجناس أو الفصائل , قد دبت فيها الحياة فجأة , فستمثل هذه الحقيقة ضربة قاتلة لنظرية انحدار الأنواع بالتحور البطيء من خلال الانتقاء الطبيعي " [SUP][25][/SUP]


[LIST][*]إذ تتمثل مشكلة التطور هنا بانطباق ما خاف منه داروين منذ أكثر من 150 عام على ما يصرح به العلماء اليوم من عدم وجود حفريات أو دلائل على كائنات انتقالية أو أشكال وسطية في سجل حفريات الكائنات الحية .[/LIST]حيث نجد مثلا أحد أشهر علماء الحيوان التطوريين ريتشارد داوكنز من جامعة أكسفورد , يقول بهذه الحقيقة ضمنيا فيقول :
" على سبيل المثال ، تعتبر طبقات الصخور الكامبرية - التي يبلغ عمرها حوالي 600 مليون سنة - أقدم الطبقات التي وجدنا فيها معظم مجموعات اللافقاريات الأساسية , ولقد عثرنا على العديد منها في شكل متقدم من التطور في أول مرة ظهرت فيها , ويبدو الأمر وكأنها زُرعت لتوها هناك , ودون أن تمر بأي تاريخ تطوري , وغني عن القول أن مظهر عملية الزرع المفاجئ هذا قد أسعد المؤمنين بالخلق " [SUP][26][/SUP]



[LIST][*]ويقول أيضا أحد مشاهير علماء الأحياء التطوريين وهو دوغلاس فوتويما معترفا بهذه الحقيقة :[/LIST]" إما أن تكون الكائنات الحية قد ظهرت على وجه الأرض وهي كاملة التطور , وإما أنها لم تظهر , وإذا لم تكن قد ظهرت في شكل كامل التطور , فلابد أنها قد تطورت من أنواع كانت موجودة من قبل عن طريق عملية تحور ما , وإذا كانت قد ظهرت في شكل كامل التطور , فلا بد أنها قد خُلقت بالفعل بواسطة قوة قادرة على كل شيء " [SUP][27][/SUP]


[LIST][*]وكذلك يقول أيضا عالم المتحجرات السويسري التطوري ستيفن بنغستون , بعدم وجود حلقات انتقالية أثناء وصفه للعصر الكامبري قائلاً :[/LIST]" إن هذا الوضع الذي أربك دارون وأخجله ما زال يبهرنا " [SUP][28][/SUP]


[LIST][*]وإذا كان اعتمد داروين في آماله على صحة نظريته على ما قد يأتي به مستقبل الحفريات بالأدلة من بعد عصره , فمن الواضح مما سبق أن ذلك لم يتحقق , وكما صرح بذلك أستاذ علم المتحجرات بجامعة غلاسكو , نيفيل جورج :[/LIST]" لا داعي للاعتذار عن فقر سجل المتحجرات ، فقد أصبح هذا السجل غنياً لدرجة يكاد يتعذر معها السيطرة عليه , وأصبح الاكتشاف فيه يسبق التكامل .. ومع ذلك ، ما زال سجل المتحجرات يتكون بشكل أساسي من فجوات " [SUP][29][/SUP]


[h=2][عدل]4. التعقيد التشريحي في أعضاء الكائنات الحية[/h][LIST][*]لقد ذكرنا من قبل تخصيص داروين للباب السادس بأكمله من كتابه للصعوبات الخاصة بنظريته والتي وقفت بقوة في وجه فكرته عن الانتخاب الطبيعي وقدراته , وما زالت إلى الآن تزداد تعقيدا بالنسبة للتطوريين كما سنرى وهي :[/LIST]الصعوبات الخاصة بنظرية النشوء مع التعديل - انعدام أو ندرة وجود الضروب الانتقالية - المراحل الانتقالية في سلوكيات الحياة - السلوكيات المتنوعة الموجودة في نفس النوع - الأنواع المتمتعة بسلوكيات مختلفة تماما عن تلك الخاصة بذوات قرباها لهما - الأعضاء التي بلغت أقصى درجات الكمال - أساليب التحول - حالات الصعوبة - الطبيعة لا تقبل الطفرة - الأعضاء ذات الأهمية الصغيرة - الأعضاء التي ليست في جميع الحالات كاملة بشكل قاطع - القانون الخاص بوحدة النمط والخاص بشروط البقاء على قيد الحياة في نطاق نظرية الانتقاء الطبيعي .
[LIST][*]حيث نقرأ مثلا لداروين قوله :[/LIST]" هل من الممكن لحيوان ما لديه مثلا التركيب والسلوكيات الخاصة بالخفاش , أن تم تكوينه عن طريق التعديل لحيوان آخر لديه سلوكيات وتركيب مختلفة تماما ؟ هل نستطيع أن نصدق أن النتقاء الطبيعي يمكنه أن ينتج عضوا ذا أهمية تافهة مثل الذيل الخاص بالزرافة الذي يستخدم كمضرب ذباب , وعلى الجانب الآخر عضوا غاية في الروعة مثل العين ؟ " [SUP][30][/SUP]


[LIST][*]ويقول أيضا بعدها وفي نفس الصفحة السابقة :[/LIST]" هل من الممكن أن تكتسب الغرائز وأن تتعدل من خلال الانتقاء الطبيعي ؟ وماذا يمكن أن نقول عن الغريزة التي تقود النحل إلى أن يصنع خلايا , وهي التي قد سبقت بالفعل الاكتشافات الخاصة بعلماء الرياضيات عميقي التفكير ؟
كيف نستطيع أن نجد تفسيرا للأنواع التي عند تهجينها تكون عقيمة , وتنتج ذرية عقيمة , بينما عندما تتهاجن الضروب فإن خصويتها لا تختل ؟ " [SUP][31][/SUP]



[LIST][*]فإذا أخذنا العين البشرية كمثال , والتي لكي تتم عملها على أكمل وجه يجب توافر 40 عامل معا لكي تبصر , فيقول عنها داروين تحت عنوان : الأعضاء التي في منتهى الكمال والتعقيد :[/LIST]" لكي يفترض أنه من الممكن أن تكون العين بكل ما فيها من أجهزة فذة من أجل ضبط الطول البؤري للمسافات المختلفة , ومن أجل السماح بدخول كميات مختلفة من الضوء , ومن أجل تعديل الزيغ الكروي واللوني , قد تكونت عن طريق الانتقاء الطبيعي , فإن ذلك يبدو , وأنا أعترف بذلك , كشيء مناف للعقل إلى أعلى درجة " [SUP][32][/SUP]
[LIST][*]وقال :[/LIST]" ..... عندئذ فإن الصعوبة في تصديق أنه من الممكن تكوين عين كاملة ومعقدة عن طريق الانتقاء الطبيعي ، مع أن هذا شيء غير قابل للتحقيق طبقا لتخيلنا ، لا يجب اعتبارها كشيء مدمر للنظرية " [SUP][33][/SUP]


[LIST][*]ومع ذلك , فأثناء محاولة داروين تفسيره لنشوء وارتقاء العين الحالية من عيون بدائية وهو الاعتقاد السائد لدى الكثير من التطوريين اليوم , فقد ساق الكثير من الافتراضات التي خرجت عن نطاق الانتخاب الطبيعي , فنسبت إليه ما يُنسب إلى الانتخاب العاقل الصناعي أو البشري وكما أشرنا من قبل , ومن ذلك يقول مثلا في افتراضه لكيفية انتقال العين البدائية من الحد الخارجي للجسم إلى داخل الجسم :[/LIST]" وبهذا التركيز للأشعة المضيئة فإننا نكتسب أول خطوة , وإلى أبعد حد , الخطوة الأكثر أهمية في اتجاه التكوين لعين حقيقية قادرة على تكوين صورة , وذلك لأنه لا يبقى لنا إلا أن نضع الطرف العاري للعصب البصري , والذي يقع في بعض الحيوانات السفلى , في موضع مدفون على عمق كبير في الجسم , وفي بعضها الآخر قريبا من السطح , على المسافة المناسبة من جهاز التركيز , وبهذا الشكل سوف تتكون عليه صورة " [SUP][34][/SUP]


[LIST][*]وبمثل هذه التفسيرات التي اعتمد فيها داروين على صفات عاقلة للانتخاب الطبيعي من وضع كذا أو ضبط كذا أو تعديل كذا , أوكل أيضا عملية تفسير العين البالغة القدرة للنسر , حتى ولو لم يمكن استنباط كيفية تطورها , حيث يقول عن الإنسان الذي سيوافقه على افتراضاته هذه بعد قراءته لكتابه أنه سيكون من الواجب عليه :[/LIST]" أن يقول بأنه عندما يتقابل مع تركيب ما , حتى ولو كان بمثل الكمال الموجود عليه عين النسر , فإنه من الممكن أن يتكون بهذه الطريقة , بالرغم من عدم معرفته في هذه الحالة لأي شيء عن المراحل الانتقالية " [SUP][35][/SUP]


[LIST][*]ثم يواصل داروين فيقول :[/LIST]" وقد ثارت اعتراضات مؤداها أنه من أجل تعديل العين وأن يتم المحافظة عليها في نفس الوقت كأداة بالغة حد الكمال , فإنه سوف يكون من الضروري إدخال الكثير من التعديلات في وقت متزامن , والتي من المفترض , أنه لا يمكن إجراؤها من خلال الانتقاء الطبيعي " [SUP][36][/SUP]


[LIST][*]فعندما شرع داروين في الرد على هذه الصعوبة , فقد أوكل الرد إلى المستر والاس والذي سبقه بفكرة الانتخاب الطبيعي من قبل , ولكننا نلاحظ أن المستر والاس بدوره لم يستطع حل هذه المعضلة إلا بافتراض تدخل عاقل هو الآخر في الانتخاب أو من جهة الكائن الحي لتعديل صفات نفسه بنفسه لمواجهة المشاكل الفيزيائية الناتجة عن عدم التزامن في تطور كل العوامل الـ 40 للعين مرة واحدة , حيث نقل قول المستر والاس :[/LIST]" إذا كان لدى عدسة طول بؤري أقصر أو أطول من اللازم , فإن هذا من الممكن إصلاحه إما عن طريق إجراء تعديل في درجة تقوسها أو تعديل في كثافتها , وإذا كان التقوس غير منتظم , والأشعة لا تتجمع لتلتقي في نقطة , ففي هذه الحالة إذا حدثت أي زيادة في الانتظام الخاص بتقوس العدسة فإنه سوف يكون تحسينا مفيدا , وبهذا الشكل فإن انقباض الحدقة والحركات العضلية الخاصة بالعين هما شيئان غير جوهريين للإبصار , ولكنهما بمثابة تحسينات كان من المحتمل أن تضاف أو تستكمل عند أي مرحلة من مراحل التركيب للأداة " [SUP][37][/SUP]


[LIST][*]وقبل ترك هذه النقطة الأخيرة , تجدر الإشارة لمن انتبه إلى الكلمات التي استخدمها داروين في كتابه , أن أغلبها هي كلمات تشكيك وافتراضات وليست عن يقين وتجربة , فإذا كان هذا هو السائد في كل كتابه , فهو أكثر بروزا ووضوحا في الباب السادس عن الصعوبات الخاصة بنظريته , وفي ذلك يقول عالم الفيزياء البريطاني H.S. Lipson :[/LIST]" من خلال قراءتي لكتاب أصل الأنواع , فقد وجدت أن دارون كان أقل ثقة ًبنفسه مما يُعرَف به دائما ً, مثلا ًالفصل صعوبات النظرية , يُظهر لنا شكه فيما يقوله . وبالنسبة لي كفيزيائي , فقد اهتممت كثيرا ًبتعليقاته حول كيفية نشأة العين , لقد وضع دارون كل آماله في الأبحاث العلمية المستقبلية لتثبت نظريته ولتحل صعوبات النظرية , ولكن ما حدث كان عكس ما توقعه دارون وطمح فيه , فكلما زادت الاكتشافات العلمية الحديثة , زادت صعوبات النظرية بشكل أكبر "
والنص باللغة الإنجليزية :
On reading The Origin of Species, I found that Darwin was much less sure himself than he is often represented to be; the chapter entitled "Difficulties of the Theory" for example, shows considerable self-doubt. As a physicist, I was particularly intrigued by his comments on how the eye would have arisen.1 Darwin invested all his hopes in advanced scientific research, which he expected to dispel the "difficulties of the theory." However, contrary to his expectations, more recent scientific findings have merely increased these difficulties. [SUP][38][/SUP]

__________________


<< حضور متقطع >>
حوار مع مسلم - اضغط هنا
ما يجب أن تعرفه عن نظرية التطور - اضغط هنا
هدم أسس الإلحاد - اضغط هنا
مدونتي - اضغط هنا
فرق ومذاهب وأحزاب وأديان معاصرة - اضغط هنا
إلى كل نصراني - اضغط هنا
فضح جهالات المدعو عمر المناصير - اضغط هنا
حقيقة المجوس الشيعة الروافض - اضغط هنا
عقد الضفيرة على شانئي أبي هريرة - اضغط هنا
الثورة المصرية .. وعقول ٌسلفية - اضغط هنا
رد مع اقتباس
إضافة رد

أدوات الموضوع

ضوابط المشاركة
لا تستطيع إضافة مواضيع جديدة
لا تستطيع الرد على المواضيع
لا يمكنك اضافة مرفقات
لا يمكنك تعديل مشاركاتك

BB code is متاحة
كود [IMG] متاحة
كود HTML معطلة


المواضيع المتشابهه
الموضوع كاتب الموضوع الأقسام الرئيسية مشاركات المشاركة الاخيرة
الامامية الاثنى عشرية تؤيد صحة عقائد أهل السنة من حيث لا تشعر ؟ وتفتي بجواز الصلاة على القطن والكتاب ابو هديل الشيعة والروافض 0 2020-01-21 06:48 AM
محبة ومن يحب علي بن أبي طالب ابن زنا إبليس أشرف منه وابليس يستفيد أكثر ممن يحب علي من مصادر الامامية ابو هديل الشيعة والروافض 0 2020-01-19 08:48 PM

 link 
*** مواقع صديقة ***
للإعلان هنا تواصل معنا > واتساب
 قطع غيار تشليح السيارات   مساج الرياض   مقاول ساندوتش بانل   yalla live   يلا لايف   bein sport 1   كورة لايف   بث مباشر مباريات اليوم   Koora live   الحلوى العمانية   حرب الإغريق 
 تنظيف منازل   شراء اثاث مستعمل   شركة تنظيف منازل بالرياض   نقل عفش الكويت   زيادة متابعين تيك توك حقيقيين   اشتراك اروما   يلا شوت   اهم مباريات اليوم   يلا شوت   شركه تنظيف في العين   سيارة كهربائية للاطفال   شركة تنظيف افران   صيانة غسالات الدمام   صيانة غسالات ال جي   صيانة غسالات بمكة   شركة صيانة غسالات الرياض   صيانة غسالات سامسونج   تصليح غسالات اتوماتيك   شركة مكافحة حشرات   شركة عزل خزانات بجدة   مظلات وسواتر   تركيب مظلات سيارات في الرياض   تركيب مظلات في الرياض   مظلات وسواتر   يلا لايف   yalla shoot   Yalla shoot   عبايات فاخرة 
 صيانة المكيفات بالمدينة المنورة   شركة حور كلين للتنظيف   شركة سياحة في روسيا   بنشر متنقل   شركة تصميم مواقع   يلا شوت   تركيب اثاث ايكيا 
 كل حصري   لوحة   yalla shoot   سوريا لايف   يلا شوت   yalla shoot   تركيب ساندوتش بانل   تركيب مظلات حدائق 
 متجر وفرة 
 شركة تنظيف بجدة   شركة تنظيف بجدة 
 certified translation office in Jeddah   شركة نقل عفش بالرياض   شركة نقل عفش بالرياض   دكتور مخ وأعصاب   شركة صيانة افران بالرياض   شركة تنظيف منازل بخميس مشيط 
 شدات ببجي   شدات ببجي اقساط   شدات ببجي   شدات ببجي تابي   شدات ببجي اقساط   شدات ببجي اقساط   شدات ببجي اقساط   شدات ببجي   شدات ببجي تابي   مجوهرات يلا لودو   شحن يلا لودو   ايتونز امريكي   بطاقات ايتونز امريكي   شدات ببجي تمارا   شدات ببجي اقساط 
 شركة نقل اثاث بالرياض   افضل شركة مكافحة النمل الابيض بالرياض   شركة تنظيف مكيفات بالرياض   شركه تنظيف بالرياض 
 نشر سناب   اضافات سناب   حسابات تويتر 
 كشف تسربات المياه   شركة تنظيف منازل   نقل اثاث بالرياض   شراء اثاث مستعمل بالرياض   نقل اثاث   كشف تسربات المياه   شركة تنظيف بالرياض   شركة عزل اسطح   عزل اسطح بالرياض   شركة عزل اسطح بجدة   كشف تسربات المياه بالرياض   شركة عزل خزانات بالرياض   كشف تسربات المياه بالخرج   تنظيف خزانات بالرياض   مكافحة حشرات بالرياض   شركة عزل اسطح بالرياض   كشف تسربات المياه بالدمام   كشف تسربات المياه بالرياض   شركة عزل خزانات بالرياض   شركة عزل فوم   كشف تسربات المياه   عزل خزانات بالاحساء   شركة نقل اثاث بالرياض   نقل عفش بالرياض   عزل اسطح   شركة تنظيف بالرياض   شركات نقل الاثاث   شركة تنظيف منازل بجدة   شركة عزل فوم   شركة عزل خزانات بالرياض   شركة تنظيف خزانات بالرياض   شركة تخزين اثاث بالرياض   شركة تنظيف مكيفات بخميس مشيط   شركة تنظيف مكيفات بالرياض   شركة عزل اسطح   كشف تسربات المياه بالرياض   شركة كشف تسربات المياه   شركة نقل اثاث بالرياض   شركة عزل اسطح بجدة   شركة عزل اسطح   عزل خزانات   شركات عزل اسطح بالرياض   شركة عزل خزانات المياه   شركة تنظيف فلل بالرياض   كشف تسربات المياه بالدمام   شركة عزل اسطح بجدة   عزل خزانات بالاحساء   عزل فوم بالرياض   عزل اسطح بجدة   عزل اسطح بالطائف 
دليل السياح | تقنية تك | بروفيشنال برامج | موقع . كوم | شو ون شو | أفضل كورس سيو أونلاين بالعربي | المشرق كلين | الضمان | Technology News | خدمات منزلية بالسعودية | فور رياض | الحياة لك | كوبون ملكي | اعرف دوت كوم | طبيبك | شركة المدينة الذهبية للخدمات المنزلية

تطوير موقع الموقع لخدمات المواقع الإلكترونية

Powered by vBulletin Copyright ©2000 - 2024 Jelsoft Enterprises Ltd
الليلة الحمراء عند الشيعة، الغرفة المظلمة عند الشيعة، ليلة الطفية، ليلة الطفية عند الشيعة، الليلة الظلماء عند الشيعة، ليلة الظلمة عند الشيعة الليلة السوداء عند الشيعة، ليلة الطفيه، ليلة الطفية'' عند الشيعة، يوم الطفية'' عند الشيعة، ليلة الطفيه الشيعه، يوم الطفيه عند الشيعه ليله الطفيه، ماهي ليلة الطفيه عند الشيعه، الطفيه، الليلة المظلمة عند الشيعة، ماهي الليله الحمراء عند الشيعه يوم الطفيه، الطفية، الليله الحمراء عند الشيعه، ليلة الظلام عند الشيعة، الطفية عند الشيعة، حقيقة ليلة الطفية أنصار السنة | منتدى أنصار السنة | أنصار السنة المحمدية | جماعة أنصار السنة المحمدية | جماعة أنصار السنة | فكر أنصار السنة | فكر جماعة أنصار السنة | منهج أنصار السنة | منهج جماعة أنصار السنة | جمعية أنصار السنة | جمعية أنصار السنة المحمدية | الفرق بين أنصار السنة والسلفية | الفرق بين أنصار السنة والوهابية | نشأة جماعة أنصار السنة | تاريخ جماعة أنصار السنة | شبكة أنصار السنة | انصار السنة | منتدى انصار السنة | انصار السنة المحمدية | جماعة انصار السنة المحمدية | جماعة انصار السنة | فكر انصار السنة | فكر جماعة انصار السنة | منهج انصار السنة | منهج جماعة انصار السنة | جمعية انصار السنة | جمعية انصار السنة المحمدية | الفرق بين انصار السنة والسلفية | الفرق بين انصار السنة والوهابية | نشاة جماعة انصار السنة | تاريخ جماعة انصار السنة | شبكة انصار السنة | انصار السنه | منتدى انصار السنه | انصار السنه المحمديه | جماعه انصار السنه المحمديه | جماعه انصار السنه | فكر انصار السنه | فكر جماعه انصار السنه | منهج انصار السنه | منهج جماعه انصار السنه | جمعيه انصار السنه | جمعيه انصار السنه المحمديه | الفرق بين انصار السنه والسلفيه | الفرق بين انصار السنه والوهابيه | نشاه جماعه انصار السنه | تاريخ جماعه انصار السنه | شبكه انصار السنه |